Labshake search
Citations for New England Biolabs :
101 - 150 of 6820 citations for Suppressor of CDC2 With RNA Binding Motif 2 RBMS1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 2.7 µl of the sample of eluted extension products were included in a 10 µl T4 RNA ligase 2 truncated KQ reaction (1× T4 RNA ligase buffer (NEB), 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Molecular Biology 2023Quote: The miRCat-33 3’ linker was ligated to the 3’ end of the RNAs on the Ni-NTA beads with 800 units of T4 RNA ligase 2 truncated K227Q (New England Biolabs) in 1 x PNK buffer / 16.67% PEG 8000 in the presence of 80 units RNasin in a total volume of 80 µl ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Genomics 2021Quote: ... at specific sequence motifs (GCTCTTCN^) in the presence of 1 μl 10X buffer 3.1 (NEB) for 2 h at 50 °C and ultra-pure water to a volume of 10 μl ...
-
bioRxiv - Immunology 2020Quote: ... RNA was then immunoprecipitated with anti-m6A antibody (New England Biolabs) overnight at 4°C with head-over-tail rotation ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 μg of total RNA was treated with DNase I (New England BioLabs) and then cleaned with RNA Clean and Concentrator-5 (Zymo Research) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 ul RNaseOUT and 1ul T4 RNA ligase 2 truncated K227Q (NEB M0351). Samples were then washed twice with PNK buffer ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 µg of total RNA was treated with DNase I (New England BioLabs) and then cleaned with RNA Clean and Concentrator-5 (Zymo Research) ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μl T4 RNA ligase 2 (truncated K227Q, NEB, 200,000 units/ml) and incubated at 16°C for 14 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of 10x T4 RNA ligase 2 (truncated) buffer (New England Biolabs), 3 μl of 50% PEG 8,000 (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA-DNA hybrids were removed with 2 U of RNase H (NEB, M0297S). The synthesized DNA was diluted 1:4 and 1 μl was used for qRT-PCR ...
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...
-
bioRxiv - Biophysics 2021Quote: ... We isolated the total RNA from 2×107 cells using a Monarch Total RNA Miniprep Kit (T2010, New England Biolabs, MA) as described by the manufacturer with an additional 30-minute ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries were created using 1000ng of total RNA with the NEBNext Ultra 2 Directional RNA Library Kit following the Poly(A) mRNA Magnetic Isolation module (NEB #E7490). Libraries were sent to Novogene for Illumina Hi-Seq ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were created using 1000ng of total RNA with the NEBNext Ultra 2 Directional RNA Library Kit following the Poly(A) mRNA Magnetic Isolation Module (NEB #E7490) and sequenced on an Illumina Hi-Seq 2000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and then the extracted RNA was treated with 2 units of DNase I (NEB) and further cleaned up via phenol-chloroform (pH 4.3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Barcoded pre-adenylated linkers were ligated using T4 RNA ligase 2 truncated K227Q (NEB) and rRNA was depleted using the Ribo-Zero gold kit (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 μl T4 RNA ligase 2 (truncated K227Q, NEB, M0242, 200,000 units/ml) and incubated at 16°C for 14 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... PNK was used to dephosphorylate RNA for 2 hours (New England Biolabs, Ipswich, MA) followed by heat-inactivation ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reverse transcriptase linker was then ligated with T4 RNA Ligase 2 truncated (NEB) and reverse transcribed using M-MLV RNase H minus (Promega) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of a mix containing 5 U of T4 RNA Ligase 2 (NEB), 1 mM ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reaction with T4 RNA ligase 2 was performed in 1x T4 Rnl2 (NEB) supplemented with PEG 8000 (10% ...
-
bioRxiv - Microbiology 2023Quote: ... the RNA samples were treated using 2 units of DNase I (New England Biolabs) according to the manufacturer’s instructions to eliminate residual gDNA ...
-
bioRxiv - Microbiology 2023Quote: ... The annealed constructs were ligated using 2 µL T4 RNA ligase2 (NEB, 10U/µL), 3 µL 0.1% BSA (Ambion) ...
-
bioRxiv - Genomics 2024Quote: ... and mixed with an equal volume of 2 x RNA loading dye (NEB, B0363S). 25 μl of the mixture was loaded on a 10% TBE-Urea gel (Bio-Rad ...
-
Investigations on regulation of miRNAs in rice reveal [Ca2+]cyt signal transduction regulated miRNAsbioRxiv - Plant Biology 2021Quote: Small RNA libraries were prepared with 2 μg of enriched small RNA using NEBNext® Small RNA Library Prep Set for Illumina® (Multiplex Compatible) (New England Biolabs) according to the manufacturer’s protocol in biological dupicates ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared from 2 ng of RNA per sample using the NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB, E6420). Libraries were pooled and sequenced using a P3-100 kit from Illumina in a NextSeq2000 sequencer following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... containing a 5′-Biotin-PC group and a 3’-OH (Sup. Table. 2) were ligated to the 5′ end of RNAs using T4 RNA ligase (NEB, Cat #M0204S) for 3 hours at 37°C ...
-
bioRxiv - Genomics 2019Quote: ... After two washes in binding buffer and one wash in ligation buffer (NEB), PE adapters (Illumina ...
-
bioRxiv - Genomics 2021Quote: - Extreme Thermostable Single-Stranded DNA Binding Protein (ET SSB, 500 ng/μL, NEB) was tested in 4 different amounts ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4.2 ng/μl extreme thermostable single-stranded DNA binding protein (New England Biolabs) and 0.02 U/μl SuperFi DNA polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The backbone was cut upstream of the binding site array using BglII (NEB) and in the YB_TATA minimal promoter using SpeI-HF (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2, truncated, NEB, 1 µL Ribolock inhibitor) was added and incubated (1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... Briefly 60 ng ±10% of total RNA was subjected to small RNA library preparation by using the NEBNext Multiplex Small RNA Library Prep Set 1 and 2 for Illumina (NEB, Ipswich, MA, USA) kit according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... treated ~2 μg RNA with RNase-free DNase I (Catalog# M0303S NEW ENGLAND Biolabs, USA), then used 1 μL treated RNA in cDNA synthesis with SuperScript III Reverse Transciptase (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 500 ng of chromatin-bound or nucleoplasmic RNA with 2 µl Quick CIP (NEB) in a total volume of 20 µl for 90 min at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... pre-tRNA stock was diluted 1 in 2 into RNA loading buffer (New England Biolabs) and separated on a 10% acrylamide urea-TBE denaturing gel ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNA (2 µg) was first annealed with 200 ng random nonamer primers (NEB S1254S) by incubation at 70°C for 5 min ...
-
bioRxiv - Genomics 2022Quote: ... were enriched from total RNA using the SARS-CoV-2 / TBRV MagIC beads (ElementZero Biolabs) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL of linker ligation mixture was added (38% PEG-8000, 1x NEB T4 ligase buffer, 2 µM oBZ407_preA preadenylated linker, 100 units NEB T4 RNA ligase 2, truncated) and they were further incubated at 37 °C for 3 hrs ...
-
bioRxiv - Biochemistry 2021Quote: ... The MCS-intein-chitin binding domain of vector pTXB1 (New England Biolabs, Ipswitch, MA) was then inserted between sites NheI and Kpn2I ...
-
bioRxiv - Plant Biology 2020Quote: ... 19 μL binding mixture containing 4 μL nuclear extracts and 5U Rnase H (NEB) or bovine pancreatic RNase A (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Non-binding mutant F211A was generated by Q5 site-directed mutagenesis (New England Biolabs)
-
bioRxiv - Molecular Biology 2022Quote: ... The recombinant proteins were affinity purified through GST tag binding to amylose resin (BioLabs) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...