Labshake search
Citations for New England Biolabs :
51 - 100 of 6820 citations for Suppressor of CDC2 With RNA Binding Motif 2 RBMS1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... was ligated to the 3’-ends of the RNA using T4 RNA Ligase 2 (NEB #M0242L) in presence of PEG 8000 (2.5% w/v) ...
-
bioRxiv - Cancer Biology 2019Quote: ... was ligated to the RNA fragments on bead using T4 RNA ligase 2 truncated KQ (NEB M0373 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and preadenylated linkers were ligated to the RNA fragments using T4 RNA Ligase 2 K277Q (NEB). After 5’ deadenlyase and RecJ exonuclase treatment ...
-
bioRxiv - Genomics 2023Quote: 1-2 µg of extracted total RNA and polysomal RNA was treated with DNaseI (NEB, M0303) in a 100 µL reaction at 37 °C for 15 min ...
-
bioRxiv - Cell Biology 2019Quote: ... A preadenylated DNA adaptor sequence was ligated to the 3’-hydroxyl ends of the RNA fragments using T4 RNA Ligase (T4 RNA Ligase 2, truncated K227Q, NEB #M0351S). The ligated RNA product was reverse transcribed using Superscript III and a barcoded primer with sequence complementarity to the adaptor ...
-
bioRxiv - Microbiology 2020Quote: ... anti-maltose binding protein (MPB) (New England BioLabs #E8032L) and anti-outer membrane protein (OmpA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the L3 DNA linker (Table S1) was ligated to RNA by T4 RNA Ligase 2 (NEB). The beads were washed with high salt buffer and PNK buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... was ligated to the RNA fragments on bead using T4 RNA ligase 2 truncated KQ (NEB M0373) at 16°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’adapter was ligated to the dephosphorylated RNA using T4 RNA ligase 2 KQ (NEB, M0373L) at 25°C for 1h ...
-
bioRxiv - Genomics 2019Quote: ... 10 µL T4 RNA ligase 2 truncated (200 U/µL, NEB) was added ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 µL of T4 RNA ligase II truncated KQ (NEB M0373), 0.5 µL of SUPERaseIN ...
-
bioRxiv - Synthetic Biology 2021Quote: ... SARS-CoV-2 RNA was replaced with nuclease free water (NEB) for the assay without the target RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 10 units/µL T4 RNA Ligase 2 (truncated K227Q, NEB). The ligation reaction was incubated for 3 hours at 22 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4 μl T4 RNA ligase 2 (NEB, catalog no. M0239) for 16 hours at 16°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 800U of truncated T4 RNA ligase 2 K227Q (New England Biolabs) in supplied PNK buffer with RNAsin (Promega ...
-
bioRxiv - Biochemistry 2022Quote: ... and RNA ligase 2 of bacteriophage T4 (New England BioLabs, Inc.). Reactions were incubated for one hour at 25 °C and ligated duplexes were purified by 1ml monoQ column (Cytiva ...
-
bioRxiv - Microbiology 2020Quote: ... 1–2 mg of RNA was treated with DNAse I (NEB), x µL and 2 µL of this reaction was used to make cDNA ...
-
bioRxiv - Biophysics 2019Quote: ... The annealed strands were ligated with T4 RNA ligase 2 (NEB), in 20 μl reactions for 1h at 37°C ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 μl of 10X T4 RNA Ligase Buffer (New England Biolabs), 1 μl of 2 μM 5’-adenylated RNA linker ...
-
bioRxiv - Biochemistry 2021Quote: ... 400 μM ATP (1x T4 RNA ligase 2 reaction buffer (NEB)) including 0.25 units/μL T4 RNA ligase 2 (Neb ...
-
bioRxiv - Microbiology 2021Quote: ... Ligation was conducted using T4 double stranded RNA ligase 2 (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 U/µl of T4 RNA ligase 2 truncated KQ (NEB), 10°C overnight) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 16 U/µl of T4 RNA ligase 2 truncated KQ (NEB), 10°C 20 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml Tris buffer ...
-
bioRxiv - Bioengineering 2020Quote: ... The motif was inserted via NEBuilder® HiFi DNA Assembly (New England Biolabs): 35 ng of the digested vector ...
-
bioRxiv - Plant Biology 2019Quote: ... 2 µg total RNA was incubated at 37°C for 30 min together with DNaseI (2 U, NEB). To inactivate the DNaseI ...
-
bioRxiv - Biophysics 2020Quote: ... for the substrate-binding domain mutants and βamHI-AlwnI (NEB) for the transmembrane domain mutants (Appendix) ...
-
bioRxiv - Genetics 2022Quote: ... N is for a random nucleotide) were ligated to the small RNA by T4 RNA ligase 2 (NEB) and T4 ligase 1 (NEB ...
-
bioRxiv - Microbiology 2020Quote: The RNA was ligated to 10.7 pmol barcode DNA linker using 200 U T4 RNA ligase 2 (NEB) overnight at 16 °C ...
-
bioRxiv - Genomics 2023Quote: ... with the ligation of 3′-small RNA Tru-Seq adapter using the truncated T4 RNA Ligase 2 (NEB). 45-150 nt capped small RNAs were recovered on 15% Urea-TBE gel (Novex ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μM of 7MeGpppA or GpppA RNA cap analogue (New England Biolabs), 10 μM adenosyl-methionine (AdoMet ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) before 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of total RNA was treated with DNase (New England Biolabs) and for the RT-qPCR experiment ...
-
Recurrent but short-lived duplications of centromeric proteins in holocentric Caenorhabditis speciesbioRxiv - Evolutionary Biology 2022Quote: ... RNA was treated with DNase I (New England Biolabs, 2 units/μl) at 37°C for 60 minutes followed by heat inactivation at 75°C for 10 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
bioRxiv - Bioengineering 2020Quote: ... the SARS-CoV-2 RNA was obtained by in vitro transcription (NEB, HiScribe™ T7 High Yield RNA Synthesis Kit ...
-
bioRxiv - Microbiology 2021Quote: ... Linker-2 (5′-GAGTCTGCGTGTGATTCGGGTTAGGTGTTGGGTTGGGCCA-3′) was ligated using T4 RNA Ligase1 (NEB). Reaction mixtures were resolved on a 10% TBE-Urea gel ...
-
bioRxiv - Microbiology 2021Quote: ... mixed with equal volume of 2× RNA Loading Dye (New England Biolabs), heated at 90 °C for 2 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 15% PEG8000 and 20 U T4 RNA ligase 2 truncated KQ (NEB)) ...
-
bioRxiv - Immunology 2023Quote: ... 2 μL of T4 RNA Ligase (10 000 U/mL, NEB, M0204S), and 10 μL of PEG 8000 50% (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... 100μg/ml single stranded DNA binding protein (gp32) from T4 (NEB), 277μg/ml T4 DNA clamp ...
-
bioRxiv - Biochemistry 2020Quote: ... small RNA library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 2) (NEB). cDNA libraries were sequenced on a HiSeq2000 platform in a spike-in format in paired-end 50 (PE50 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by annealing and ligation with a DNA/RNA-hybrid stem-loop adapter using T4 RNA ligase 2 (New England Biolabs), which specifically ligates the adapter to mature tRNA ...
-
bioRxiv - Microbiology 2019Quote: ... The Illumina RA3 adapter sequence was ligated to the purified RNA using T4 RNA Ligase 2 (NEB, cat. number: M0242) for 2 hours at 25 °C and reverse transcription was performed with Reverse Transcription Primer (Illumina sequence ...
-
bioRxiv - Genomics 2021Quote: ... Purified RNA was fragmented 2-4 minutes (depending on the RNA Integrity Number) using NebNext Magnesium RNA Fragmentation Module (New England Biolabs) and once again purified with the RCC kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...