Labshake search
Citations for New England Biolabs :
101 - 150 of 4138 citations for R 4 Benzyl 2 2 diphenylphosphino benzyl 4 5 dihydrooxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and 4 mM SAM (NEB). RNAs were then purified with the RNA Clean and Concentrator-5 Kit (Zymo) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 4 mM dNTPs (NEB #N0447L), 250 nM PAGE-purified forward and reverse primers ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 U Turbo DNase (NEB) and 3 U FastAP enzyme (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Physiology 2021Quote: ... 5’ end repair was done using T4 PNK with 2 mM ATP (NEB P0756S). Following RNA purification with Zymo Oligo Clean & Concentrator (D4060) ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Developmental Biology 2023Quote: ... On-Bead 5’ Decapping reaction was done using NEBuffer 2 buffer (NEB, B7002S ®). Off-Bead Reverse Transcription followed the instructions in SuperScript ® IV Reverse transcriptase kit ...
-
Differential impact of a dyskeratosis congenita mutation in TPP1 on mouse hematopoiesis and germlinebioRxiv - Cell Biology 2021Quote: ... 5′ 32P-labeled (TTAGGG)4 oligonucleotide (labeled using [γ-32P]ATP and T4 PNK; New England Biolabs) was added ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nuclei were centrifuged (500xg, 5 min, 4°C) and washed once with 1X NEBuffer 2.1 (NEB, #B7202). For nucleosome depletion ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Nuclei were pelleted at 500 ξ g at 4°C for 5 minutes and resuspended in 0.5 mL of 1.2x NEBuffer r2.1 (New England Biolabs) containing 3% sodium dodecyl sulfate (SDS ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 (NEB #E7500) and 3 (NEB #E7710 ...
-
bioRxiv - Cell Biology 2021Quote: ... and DNA fragments were amplified by PCR with NEXTFlex primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) and further purified with AMPure XP beads to eliminate unligated primers and adapters ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were amplified by PCR using NextFlex PCR primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) before three further rounds of AMPure XP purification were performed to collect fragments 150-300 bp in size ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 uL aliquots were removed at each time point and added to 2 uL 5 mg/mL Proteinase K (NEB) in 5% SDS ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of RCA mixture was combined with 4 μl Restriction enzyme buffer (New England Biolabs), 13 μl MilliQ ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Phusion High Fidelity 2× Master mix (New England Biolabs, Beverly MA, USA) and 2 μL of 10 μM standard Illumina P1 and P2 primers ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was removed by adding 2 μL DNaseI and 5 μL 10x DNase buffer (NEB) to the purified RNA and incubated at 37C for 30 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4 U DNase I (NEB) was used for each 200 μl to digest the DNA nanoswitches at 37 °C for 1 hour ...
-
bioRxiv - Bioengineering 2021Quote: ... 4 μl 10mM dNTPs (N0477L, NEB), 1 μl RNase Inhibitor (30281 ...
-
bioRxiv - Genetics 2020Quote: ... 4 μl T4 DNA polymerase (NEB), 1 μl DNA polymerase Klenow (NEB) ...
-
bioRxiv - Pathology 2020Quote: ... 4 U/ml RNase inhibitor (NEB) and proteinase inhibitor cocktail (Roche ...
-
bioRxiv - Genetics 2020Quote: ... 4 Units of terminal transferase (NEB) were added together with dCTP in a final concentration of 0.1 mM ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 U of Proteinase K (NEB) were added to the reaction and incubation continued for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... 4 mg/ml BSA (NEB B9000S), 300 U/μl RL Lysozyme ...
-
bioRxiv - Microbiology 2020Quote: ... and 4 U/ml apyrase (NEB) were added and the reaction was incubated overnight at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
bioRxiv - Genomics 2024Quote: ... 4 μl of Inorganic Pyrophosphatase (NEB) and 2 μl of Phi29 DNA Polymerase (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 0.67x NEB buffer 4 (NEB, B7004S), 0.13% Triton X-100 (sigma ...
-
bioRxiv - Biophysics 2024Quote: ... 4 U Murine Rnase Inhibitor (NEB), 5 mM EDTA ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 μL T7 polymerase (NEB #M0251S), 24 μL template DNA (adjusted to 0.3 μM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2′ O-methylated using Vaccinia VP39 (2′ O Methyltransferase) (NEB) in a reaction that also included 1X capping buffer (NEB) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... αlvus tRNAPyl (Ma-tRNAPyl)35 was prepared by annealing and extending the ssDNA oligonucleotides Ma-PylT-F and Ma-PylT-R (2 mM, Supplementary Table 1) using OneTaq 2x Master Mix (NEB). The annealing and extension used the following protocol on a thermocycler (BioRad C1000 Touch™) ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2′O-methylated using Vaccinia 2′O Methyltransferase (New England Biolabs). The IRES-containing mRNAs were uncapped and polyadenylated.
-
bioRxiv - Developmental Biology 2023Quote: Rehydrated embryos were blocked for 2 hs in 2% BSA (B9000, NEB) in PBS with 0.3% Triton X-100 (T9284 Sigma) ...
-
bioRxiv - Biophysics 2024Quote: Rehydrated embryos were blocked for 2 h in 2% BSA (B9000, NEB) in PBS with 0.3% Triton X-100 (T9284 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... This was added to 5 ml (per 2 L of culture) amylose resin (New England Biolabs) equilibrated in lysis buffer and left on a tube roller shaker at 4 °C for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl 10 mM MnCl2 buffer and 0 or 2 μl lambda phosphatase (NEB #P0753S, USA) in 38 μl supernatant ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl 1 M DTT and 5 µl T4 polynucleotide kinase (NEB, 10 U/µl, #M0201) and incubated at 37 °C for 2 h ...
-
bioRxiv - Genomics 2021Quote: ... 2 U M.CviPI (NEB), 160 μM S-adenosylmethionine (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM dNTPs (NEB), 0.5 µM forward and reverse primers (IDT) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 2 μl DTT (NEB) and 2 μl of ProtoScript® II were added and the mixture incubated at 42°C for 12 hours with a 105°C heated lid ...
-
bioRxiv - Microbiology 2023Quote: ... in NEBuffer 2 (NEB) for 2 h at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM ATP (NEB) in a total volume of 25 μl ...
-
bioRxiv - Genomics 2023Quote: ... 1X NEBuffer 2 (NEB), 0.5 μM P5 primer ...
-
bioRxiv - Bioengineering 2021Quote: ... 4 µg plasmid was digested for 4 h at 37°C with BstXI and XhoI (New England Biolabs). Products were run on a 1% agarose gel for 30 min at 120 V ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... with the genotype fhuA2 [lon] ompT gal sulA11 R(mcr-73::miniTn10--Tet)2 [dcm] R(zgb-210::Tn10--Tet) endA1 Δ(mcrC-mrr)114::IS10(New Engalad Bioloabs, NEB) was used in this study ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 U of T4 DNA polymerase (NEB), 13.5 U of T4 Polynucleotide Kinase (NEB ...