Labshake search
Citations for New England Biolabs :
451 - 500 of 4138 citations for R 4 Benzyl 2 2 diphenylphosphino benzyl 4 5 dihydrooxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... RHA PCR products were ligated into pAAV p21 vector by Gibson assembly at a ratio vector:inserts of 1:2:2 using T4 DNA ligase (NEB). All constructs were checked by sequencing before transfection into cells ...
-
bioRxiv - Biochemistry 2021Quote: ... sDrl-2 for crystallization was also partially deglycosylated with PNGase F (New England BioLabs: 2,000 unit/mg sDrl-2) for 3 h at room temperature before sizing.
-
bioRxiv - Biochemistry 2021Quote: ... 2 μl of this lysate was directly used for PCR reactions with 2× Taq start master mix (M0496L, NEB), and the two NASP clone screening primers (see primer table) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... These were phosphorylated (2 μL 100 μM oligo stock, 2 μL 10X T4 DNA ligase buffer (New England Biolabs), 1 μL T4 PNK (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 nM dT adaptor primer and 200 nM Vλ1-GSP4-2-Hind III and 2 U Taq polymerase (NEB), in a final volume of 50 µl ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μl each of two complementary oligonucleotides (Mut_sgRNA_F and Mut_sgRNA_R) (Supplementary file 1) at a concentration of 20 μM and 2 μl of NEBuffer 2 (NEB B7002S) were added into an Eppendorf tube ...
-
bioRxiv - Microbiology 2024Quote: ... The gel-extracted nascent RNA in 5 µl nuclease-free water was ligated to 10.7 pmol barcode DNA linker (Supplementary Table 2) using 200 U truncated T4 RNA ligase 2 (NEB) overnight at 16°C ...
-
bioRxiv - Microbiology 2023Quote: ... pUA_minusFP_R: 5’ggatccatcgaggtgaagacg) and circularizing the product with a bridging oligonucleotide (5’cgtcttcacctcgatggatccatgtccagacctgcaggcatg) using the NEBuilder® HiFi DNA Assembly (NEB) kit ...
-
bioRxiv - Cell Biology 2020Quote: ... After ligation at RT for 4 h with T4 ligase (NEB), the nuclei were pelleted ...
-
bioRxiv - Genomics 2020Quote: ... with 4 μl (400 U/μl) of T4 DNA ligase (NEB) in a final volume of 200 μl at 16°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 μL of 20 mg/mL Proteinase K (New England BioLabs) was added and incubated for 1 h at 55 °C ...
-
bioRxiv - Immunology 2022Quote: ... 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Bioengineering 2021Quote: ... 2.5 µL of 4 mM dNTPs (New England Biolabs, Ipswich, MA), and SuperScript II RT Enzyme (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2020Quote: ... and 4 μl of T4 DNA polymerase (NEB M0203, 3U/μl), and incubating at 37 °C for 1 hour with rotation ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplied with the enzyme) and 4 units of DNAse I (NEB) were incubated at 37 °C for 60 min ...
-
bioRxiv - Cell Biology 2021Quote: ... pCFD4_Lamp_13 pCFD4_lamp1-30_4-4 were made by Gibson assembly (NEB # E5510S) using oligos Lamp1_crips_61_for ...
-
bioRxiv - Immunology 2022Quote: ... 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Molecular Biology 2022Quote: ... and α1-3,4 fucosidase (New England Biolabs, 4 U/μg protein). All enzymatic reactions were performed as a 1-step reaction with 1x Glycobuffer 2 (New England Biolabs) ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μL of 20 mg/mL Proteinase K (New England BioLabs) was added and incubated for 1 hours at 55°C ...
-
bioRxiv - Pathology 2021Quote: ... 4 μM of each gRNA was combined with Cas9 (NEB #M0646) and Cas9 buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μL NEBNext Second Strand Synthesis Enzyme Mix (New England Biolabs), and 48 μL water ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µl exonuclease T with 10 µl buffer 4 (NEB) was used in the enzymatic reaction ...
-
bioRxiv - Genomics 2022Quote: ... but instead incubated with 4 units of Dam enzyme (NEB, M0222L) during the activating step ...
-
bioRxiv - Plant Biology 2022Quote: ... Supernatants were treated with 4 µL of DNAse I (NEB, EN0521) and incubated for 10 min at 37°C with shaking at 1,200 rpm ...
-
bioRxiv - Systems Biology 2024Quote: ... Samples were then treated with 4 units of DNase I (NEB) for 1 hr at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 μl of 6x Gel Loading Dye (B7025S, New England Biolabs) and 1 μl of 2.5 mg/ml EtBr were added to the RNA size markers.
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of 20 mg/mL Proteinase K (New England BioLabs) was added and incubated for 1 h at 55 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 units of BstBI (R0519 New England Biolabs Inc., Ipswich MA) was added ...
-
bioRxiv - Immunology 2023Quote: ... 4 U/μL Exonucluease I (New England Biolabs, cat.: PN MO293L) was added to the preamplification mix and incubated in the thermocycler for 30 min at 37°C and 15 min at 80°C to remove non-incorporated primers.
-
bioRxiv - Microbiology 2024Quote: ... followed by a 4-hour linearization with XbaI endonuclease (NEB, Canada) at 37 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 mM DTT) supplemented with 80 μM S-adenosylmethionine (NEB, B9003S) at 30°C overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... 240 nM dT-primer and 4 U RNase Inhibitor (NEB, M0314L). Reverse transcription was performed at 42°C for 90 min after filling up to 10 µL with RT buffer mix for a final concentration of 1X Superscript II buffer (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... was utilized using SARS-CoV-2 specific primers[43] or SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (New England Biolabs), which became available in assays after September 15 ...
-
bioRxiv - Biophysics 2020Quote: For the insertion of an ATTO647N-labeled oligonucleotide complementary to the position 14711 bp from the biotinylated end of the λ DNA we employed the previously described strategy14 and followed the more recently described procedure.15 2 μg of λ DNA was incubated for 2 hours with the nicking enzyme Nt.BstNBI (20 units, NEB) at 50 °C in the nickase buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR product (2 μg) and pEYFP-C1 vector DNA (2 μg) were digested with BamHI-HF and HindIII-HF (New England Biolabs) according to the manufacturer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The annealing was carried out in 96-well PCR plates by mixing 2 μL of each oligonucleotide at 100 μM with 2 μL of 10x T4 DNA Ligase Reaction Buffer (NEB) and 14 μL of water ...
-
bioRxiv - Systems Biology 2021Quote: ... PCR reactions with plasmid and genomic DNA templates were performed using the Phusion High-Fidelity 2× Master Mix or Q5 High-Fidelity 2× Master Mix (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... was amplified and barcoded in parallel using the same PCR program in 50 μL PCR reaction (2 μL gap-repaired DNA, 25 μL 2× NEBNext High-Fidelity PCR Master Mix (NEB), 1.5 μL 10 μM i5 universal PCR primer ...
-
bioRxiv - Microbiology 2022Quote: ... human NINL isoform 2 (NCBI accession NM_001318226.2) and the NINL isoform 2 mutant (Q231R) were mutagenized using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). The plasmids encoding 3C proteases (coxsackievirus B3 (CVB3 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we first mixed 10.5 uL of purified RNA with 2 uL of 2 uM RT primer (AGGGACATCGTAGAGAGTCGTACTTANNNNNNNNNNAGATGAACTTCAGGGTCAGC, where Ns comprise the UMI) and 2uL of 10mM dNTP mixture (NEB), incubated the mixture at 65C for 5 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... A repair template for editing endogenous plk-2 gene to express PLK-2::3xFLAG::TIR1CIP was assembled into a pCR-Blunt backbone using Gibson Assembly (NEB) and confirmed using Sanger sequencing and whole-plasmid Nanopore sequencing (Primordium) ...
-
bioRxiv - Genetics 2020Quote: For Southern blot analysis 150 ng of mouse DNA was digested with 10 units of BamHI-HF (NEB, Figure 2 and 5), NdeI (NEB ...
-
bioRxiv - Physiology 2021Quote: ... and 72 °C for 5 min) using a Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) and primers containing the restriction sites of SpeI or BglII for subsequent subcloning (F ...
-
bioRxiv - Cancer Biology 2022Quote: ... to remove the 3’-phosphate group from the uncharged tRNA followed by ligation to 5’-adenylated uniquely barcoded adapters using RNA ligase 2 truncated KQ (New England BioLabs, Cat. # M0351L). The resulting tRNAs were then ligated to a 5’-adaptor ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 41.7 µL of Phusion 2× Master Mix (NEB), 2.5 µL of 10 µM primer mix (515F forward and 806R reverse rRNA gene V4 primers with Illumina MiSeq adaptors) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... treated with 2 units of DNase I (NEB) at 37°C for 1 hour followed by DNase I heat inactivation ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl Antarctic Phosphatase [5k U/mL] (NEB) and 1 μl RNase inhibitor and incubating at 37 °C for 30 minutes with shaking ...
-
bioRxiv - Genomics 2021Quote: ... 10 µL of 2% BSA (New England Biolabs), 930 µL of nuclease-free water and supplemented with 0.2 U/ul RNaseIN Plus (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl RNase Inhibitor (80U final, NEB M0307L) and 2 µl SuperScript III (400U final ...