Labshake search
Citations for New England Biolabs :
101 - 150 of 1692 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl of Universal nuclease (Pierce; 125U/L of culture) and 10 μl of DNaseI (NEB; 20U/L of culture) were added and the mixture allowed to incubate for 10 min at RT ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 l of the DNA was used in a 50 l PCR reaction with the enzyme Q5 polymerase (New England Biolabs) and the primers Cytb-f AGTCCTAGTGTAATGGAAGCand Cytb-r ATCTTCAACGTGTTTAGCACC (annealing temperature 61.5°C) ...
-
bioRxiv - Microbiology 2021Quote: ... L: 100 bp DNA Ladder (New England Biolabs). 1 ...
-
bioRxiv - Bioengineering 2023Quote: T4 Polynucleotide Kinase (NEB cat. no. M0201S/L)
-
bioRxiv - Bioengineering 2023Quote: Bsu36I restriction enzyme (NEB cat. no. R0524S/L)
-
bioRxiv - Genomics 2020Quote: ... A-tailing 3’ end was performed using Klenow Fragment (3’→5’ exo-) (New England Biolabs), and then TruSeq Adapters were ligated by Quick T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by addition of 3’-A overhangs using Klenow Fragment 3’-5’ exo- (NEB, M0212S). After denaturation of DNA at 95°C for 3 min ...
-
bioRxiv - Cell Biology 2021Quote: ... A-tailing 3’ end was performed using Klenow Fragment (3’→5’ exo-) (New England Biolabs), and then TruSeq Adapters were ligated by Quick T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Genetics 2023Quote: ... Index primers set 1 and 2 from the NEBNext Multiplex Oligos for Illumina kit (New England Biolabs, E7335S/L E7500S/L) were incorporated using Herculase II Fusion Polymerase Kit (Agilent ...
-
bioRxiv - Immunology 2022Quote: ... N-glycans were enzymatically removed from the underlying peptides with PNGase F (NEB) overnight at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... pGEM-N-SNAPf was first constructed by removing SNAPf from pSNAPf (NEB, N9183S) with AgeI-XhoI and inserting it into the AgeI-XhoI site of pGEM-HE (51) ...
-
bioRxiv - Cell Biology 2020Quote: ... was then cloned at the N-terminus of Atg11 using Gibson Cloning (NEB) to generate 2GFP-Atg11 yCPLAC33 (Li et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reaction was set up using ARCA (NEB, S1411L or Trilink, N-7003-5) and N1-Methylpseudouridine-5’-Triphosphate (Trilink ...
-
bioRxiv - Molecular Biology 2023Quote: ... digested O/N at 42°C with 3U β-agarase (New England Biolabs) and again for 2 hrs with 2U β-agarase ...
-
bioRxiv - Cell Biology 2023Quote: ... The Peptide-N-Glycosidase F (PNGase F) enzyme (New England Biolabs, catalog #: P0704L)-treated samples served as a control for unglycosylated α1 subunits ...
-
bioRxiv - Immunology 2023Quote: ... N-glycans were enzymatically removed from the tryptic peptides with PNGase F (NEB) overnight at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3’ end filling and dA tailing was performed by Klenow Fragment (3’>5’ exonuclease deficient; NEB). Libraries were prepared by ligation of NEBNext adapters and indexed i7 primers (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Molecular Biology 2021Quote: ... 3 ml of Thermolabile ExoI (BioLabs) was added to each reaction and samples were incubated for 15 min at 37 °C ...
-
bioRxiv - Genomics 2019Quote: ... 3 µL Klenow exo (NEB M0212S)] to the 32 µL of DNA sample from the previous step ...
-
bioRxiv - Genomics 2019Quote: ... 3 U Klenow exo (NEB M0212S)] to the 32 µL of DNA sample from the previous step ...
-
bioRxiv - Genomics 2019Quote: ... 3 U Klenow exo (NEB M0212S)] to the 32 µL of DNA sample from the previous step ...
-
bioRxiv - Bioengineering 2021Quote: 3 μL of 5′-deadenylase (NEB) were added to ligation reaction,
-
bioRxiv - Molecular Biology 2021Quote: ... Then 3 μl USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’ overhangs removed with Klenow (NEB) to form blunt ends ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µl T4 DNA ligases (NEB), and 2 µl of a 15 µM Illumina indexed adapter at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL 10xDNase I Buffer (NEB), and 24 μL WB2 ...
-
bioRxiv - Plant Biology 2022Quote: ... and 3 (NEB, catalog No. E7500S) following manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 3 μL USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 µL RNase A (NEB) in volumes normalized to OD600 of culture samples ...
-
bioRxiv - Genomics 2023Quote: ... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 μl QuickCIP enzyme (NEB) at 37°C for 10 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2023Quote: ... Klenow Fragment (3’→5’ exo-) (NEB) was diluted in 1X NEBuffer 2 to a final concentration of 2 U/μL ...
-
bioRxiv - Neuroscience 2023Quote: ... Then 3 μL USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Microbiology 2023Quote: ... 3 µL 10x reaction buffer (NEB), 0.25 µl 1 M MgCl2 and 0.3 µl Rnasin ribonuclease inhibitor (Promega ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Biophysics 2019Quote: ... and L+512 were each digested with HindIII (NEB) for one h at 37 °C in the CutSmart™ buffer (NEB) ...
-
bioRxiv - Bioengineering 2023Quote: BsaI-HFv2 restriction enzyme (NEB cat. no. R3733S/L)
-
bioRxiv - Molecular Biology 2020Quote: ... the 3’ adapter was first ligated using 0.5 μl of 3’SR Adapter for Illumina (NEB-kit) added to 30 ng of input RNA diluted in 3.0 μl nuclease free H2O ...
-
bioRxiv - Plant Biology 2021Quote: ... The antisense strand with a 3′ phosphate was radiolabeled by T4 Polynucleotide Kinase (3’ phosphatase minus) (NEB) and [γ-32P]ATP ...
-
bioRxiv - Biochemistry 2020Quote: ... tsetse saliva was treated with peptide-N-glycosidase A (PNGase A, New England Biolabs), which releases all N-linked glycans ...
-
bioRxiv - Cell Biology 2021Quote: ... N-hydroxysuccinimide ester (BG-GLA-NHS) functionalized benzylguanine was purchased from NEB (Cat #S9151S) and freshly reconstituted in DMSO to a final concentration of 83 mM ...
-
bioRxiv - Biochemistry 2022Quote: The standard N-glycoprotein bovine pancreatic ribonuclease B (RNase B, New England Biolabs, USA) was used as a substrate to measure NGLY1 activity ...
-
bioRxiv - Molecular Biology 2022Quote: Removal of N-linked glycosylation was performed using PNGaseF (New England Biolabs, Ipswich, USA) at a concentration of 125 U/μg protein ...
-
bioRxiv - Immunology 2021Quote: ... 1 µL of 10 mM dNTP (cat. n° N0447L, NEB, New England Biolabs, USA), 0.2 µL of RNase Inhibitor 40 U / µL (cat ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of 0.1 M Dithiothreitol (cat. n° M0368L, NEB, New England Biolabs, USA), 1 µL of 10 mM dNTP (cat ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of 0.1 M Dithiothreitol (cat. n° M0368L, NEB, New England Biolabs, USA), 1 µL of 10 mM dNTP (cat ...
-
bioRxiv - Immunology 2021Quote: ... 1 µL of 10 mM dNTP (cat. n° N0447L, NEB, New England Biolabs, USA), 0.2 µL of RNase Inhibitor 40 U / µL (cat ...