Labshake search
Citations for New England Biolabs :
101 - 150 of 10000+ citations for Human Hypoxia inducible factor 3 alpha HIF3A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... the purified 8.2 kb DNA linker was annealed to the oligo DNA handle with 3’-biotin (5’-TGGACTGATGCGGTATCTGCGATATCCTA CGCAGGCGTTT-3’-biotin) in PBS at room temperature for 3 hr followed by purification using Monarch DNA purification kit (NEB).
-
bioRxiv - Molecular Biology 2020Quote: ... PCR mutagenesis to create site-directed mutants of malM 3’-UTR and cspE 3’-UTR was conducted with the Q5 site-directed mutagenesis kit (New England Biolabs) using end-to-end primers designed with NEBaseChanger ...
-
bioRxiv - Genetics 2022Quote: The detection of aberrant Scyl1 transcripts was performed by RT-PCR using primers designed to amplify sequences between exon 2 to exon 5 (RT-Scyl1_F21 5’-CGCAGTGTCCATCTTCGTGTA-3’ and RT-Scyl1_R51 5’-CCCGGCAGTTCTGCAGGAA-3’) following the OneTaq One-Step RT-PCR Kit (New England Biolabs, E5315S) procedure ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... was first transformed into NEB 5-alpha competent cells (New England Biolabs #E2621S) and plated on LB plus ampicillin (60 µl/ml).
-
bioRxiv - Molecular Biology 2022Quote: ... The ligation was directly transformed into NEB-5-alpha electrocompetent cells (NEB C2987H) and plated on LB-agar supplemented with carbenicillin (100 µg/mL) ...
-
bioRxiv - Biochemistry 2023Quote: ... NEB Stable (lentiviral vectors) and NEB 5-alpha (other plasmids) (New England Biolabs) were used as cloning strains ...
-
bioRxiv - Biochemistry 2023Quote: ... The plasmids were then transformed into DH5-alpha high-efficiency competent cells (NEB). Following transformation ...
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... Human FBP1 mutants were constructed by Q5 Site-Directed Mutagenesis Kit (NEB, E0554S) in the PCDH-V5-FBP1 vectors ...
-
bioRxiv - Biochemistry 2020Quote: ... the human Rab1b 3-174aa (referred to as Rab1b)-encoding DNA was cloned into a modified pMAL vector (New England Biolabs), resulting in a construct with a N-terminal hexahistidine (6xHis ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mix of 5 μl 3’Ligation Reaction Buffer 2x (NEB-kit) and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Genetics 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligas’ 2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB) creating pmpsB ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using KpnI and SacI restriction sites and T4 DNA ligase (NEB). This was transformed into RN4220 and eventually into the respective NTML mutants through electroporation.
-
bioRxiv - Microbiology 2020Quote: ... the plasmid pMK47 containing an inducible mKate2 construct was constructed by digesting the pUC18-mini-Tn7T-LAC vector with NsiI and Eco53kI restriction enzymes (NEB)43 ...
-
bioRxiv - Microbiology 2023Quote: ... PCR amplified yciF (with Strep II tag on C-terminal) and pQE60 plasmid (containing an IPTG inducible T5 promoter) were digested with BamHI and EcoRI (New England Biolabs) and purified by gel extraction (MinElute gel extraction kit ...
-
bioRxiv - Microbiology 2023Quote: ... were synthesized by Twist Bioscience as gene fragments and assembled into the pBAD plasmid13 under the arabinose-inducible pBAD promoter by Gibson assembly (New England Biolabs) (Table S1) ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR product was cloned into the tetracycline inducible plasmid pRMC226 using KpnI and SacI restriction sites and T4 DNA ligase (NEB). This was transformed into RN4220 and eventually into the respective NTML mutants through electroporation.
-
bioRxiv - Microbiology 2023Quote: ... PCR amplified target genes and pQE60 plasmid (containing an IPTG inducible T5 promoter) were digested with BamHI and HinDIII (New England Biolabs) and purified by gel extraction (MinElute gel extraction kit ...
-
bioRxiv - Synthetic Biology 2023Quote: ... all mutants were cloned from the arabinose-inducible bARGSer plasmid6 (https://www.addgene.org/192473/) using Gibson assembly with enzyme mix (New England Biolabs, Ipswich, MA). A bacterial expression plasmid encoding GFP under the same promoter and backbone was used as a control in the same manner as the fluorescent protein controls described in Hurt et al6 ...
-
bioRxiv - Cell Biology 2023Quote: ... a sequence encoding mCherry was added on one side of the tet-inducible bi-directional promoter by conventional restriction cloning (BamHI & SpeI; New England Biolabs). The coding region of a human F-box domain (215 amino acids [aa] ...
-
bioRxiv - Microbiology 2020Quote: ... the resin was treated with factor Xa protease (P8010L, NEB) overnight at 4°C ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... the MPB tag was cleaved overnight using Factor Xa (NEB) in dialysis buffer and loaded again on an MBP-Trap HP column ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 μL of factor mix (with RNA polymerase, and transcription/translation factors in 10 mM Mg2+) from the PURExpress® Δ Ribosome Kit (New England Biolabs). The reaction buffer was based on Shimizu et al ...
-
bioRxiv - Immunology 2019Quote: ... PCR product was cloned into 5-alpha competent bacteria (New England Biolabs, cat. #C2987) using a TOPO TA cloning kit (Thermo Fischer Scientific ...
-
bioRxiv - Microbiology 2022Quote: Escherichia coli DNA adenine methyltransferase (dam)+/dcm+ (NEB 5-alpha competent E. coli, #C2987) and dam−/dcm− (dam−/dcm− competent E ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformations were performed using NEB 5-alpha chemically competent cells (New England BioLabs). E ...
-
bioRxiv - Biochemistry 2022Quote: ... aliquots of S proteins were digested respectively using alpha lytic protease (New England BioLabs), chymotrypsin (Athens Research and Technology) ...
-
bioRxiv - Microbiology 2023Quote: ... All the produced constructs were propagated in competent cells (5-alpha Competent E.coli; NEB) and isolated by NucleoSpin Plasmid (TaKaRa) ...
-
bioRxiv - Genomics 2024Quote: ... Ligation products were transformed into either 5-alpha or 10-beta electrocompetent cells (NEB) and grown in liquid LB-Amp cultures ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared using the NEBNext Immune Sequencing Kit for Human (New England Biolabs) according to the manufacturer’s instructions without modifications ...
-
bioRxiv - Microbiology 2020Quote: ... and one fragment of about 320 bp of the 3’-terminal region by 3’ RACE were amplified using Phusion High-Fidelity PCR Kit (New England Biolabs, MA, USA) under the following conditions [98°C ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Cell Biology 2019Quote: ... red fluorescent protein coding sequence (dsRed) were cloned into the above derivative tetracycline inducible plasmid with NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) at NheI and MluI restriction sites (pLVD-GRASLND and pLVD-dsRed) ...
-
bioRxiv - Molecular Biology 2019Quote: Libraries were prepared with NEBNEXT rRNA Depletion kit (human/mouse/rat) and NEBNEXT Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... MBP was cleaved from LH using Factor Xa (New England Biolabs) at a w/w ratio of 1% Factor Xa:LH ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli using standard transformation techniques with NEB 5-Alpha chemically competent cells (New England BioLabs), and to C ...
-
bioRxiv - Synthetic Biology 2023Quote: All cloning was performed in NEB 5-alpha Competent Escherichia coli (New England BioLabs C2987U). The Pseudomonas putida KT2440 strain was purchased from ATCC (#47054) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The assembled plasmid was introduced into Escherichia coli strain NEB 5-alpha (New England Biolabs) by heat shocking ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids were amplified in chemically competent 5-alpha F’Iq Escherichia coli cells (New England Biolabs) after 42°C heat shock transformation and extracted using the GenElute HP Plasmid Miniprep Kit (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... plasmids were chemically transformed into DH5-alpha cells (cat no. C2987, New England Biolabs Inc.) and plated on agar plates containing appropriate antibiotics ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were amplified using NEB 5-alpha F′ Iq competent Escherichia coli (NEB, Cat# C2992H) and extracted using the PureYield Plasmid Miniprep System (Promega ...