Labshake search
Citations for New England Biolabs :
401 - 450 of 10000+ citations for Human Hypoxia inducible factor 3 alpha HIF3A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2022Quote: ... adenosine addition at 3’ end (NEB, M0212), ligation of Illumina indexed adapters (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Microbiology 2020Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3 U of T4 DNA polymerase (NEB), 9 U of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 units of T4 DNA polymerase (NEB), 9 units of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 3 μl of BSA (New England BioLabs), sterile MilliQ water up to 50 μl and 10 ng of DNA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Immunology 2022Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genetics 2022Quote: ... with Klenow fragment (3’-5’ exo-; NEB). Hybridization signals were obtained using Typhoon FLA 7000 (GE Healthcare ...
-
bioRxiv - Physiology 2022Quote: ... 3 μl USER Enzyme (New England BioLabs) was then used with size-selected ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 U of T4 DNA polymerase (NEB), 9 U of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 units of USER enzyme (NEB, Cat.No.M5505) and 40units of recombinant rnase inhibitor was added into elution products and incubated at 37°C for 20min for DNA strand digestion ...
-
bioRxiv - Developmental Biology 2020Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Zoology 2020Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Plant Biology 2020Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3 μL CutSmart buffer (New England Biolabs), 20 μL DNA solution (50 ng total DNA ...
-
bioRxiv - Developmental Biology 2019Quote: ... 7.5U Klenow 3’-5’ exo minus (NEB) were incubated for 30 min at 37°C ...
-
bioRxiv - Pathology 2021Quote: ... 3 µL of DNAse I (NEB, USA) were added ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 μl ThermoPol Buffer (New England Biolabs), 1 μl dNTPs (10 mM) ...
-
bioRxiv - Microbiology 2020Quote: ... consisting of 3 μL DNase I (NEB), 3 μL 10xDNase I Buffer (NEB) ...
-
bioRxiv - Immunology 2021Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Pathology 2022Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Cell Biology 2022Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Microbiology 2023Quote: ... 10% NEBuffer 3 (New England Biolabs, #B7003S) in a thermocycler at 85°C for 3 min ...
-
bioRxiv - Genomics 2023Quote: ... 3 µl of Lambda Exonuclease (NEB, #M0262L), and 3 µl of Exonuclease I (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Cancer Biology 2023Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2024Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 μl of PvuI (NEB, Cat. R3150S) PacI (NEB ...
-
bioRxiv - Immunology 2022Quote: ... with short homologies for Gibson assembly and cloned into human IgG1 or human IgL2 expression vectors using the NEB Hifi DNA Assembly mix (NEB, Cat#E2621L). Plasmid sequences were verified by Sanger sequencing (Genewiz).
-
The conserved metalloprotease invadolysin is present in invertebrate haemolymph and vertebrate bloodbioRxiv - Cell Biology 2019Quote: ... Human plasma was treated with PNGase F (NEB; P0704S) or a mixture of O-Glycosidase (NEB ...
-
bioRxiv - Biophysics 2020Quote: ... as with commercially available human H1 (hH1) (M2501S; NEB), sharing 96.5% identity with mH1 (Fig ...
-
bioRxiv - Biochemistry 2023Quote: ... and human casein kinase II (New England BioLabs, #P6010).
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... Recombinant human Histone H2A (New England BioLabs, Catalog # M2502S) or H4 (New England BioLabs ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... and a 956 bp fragment of omp-pst2 gene was amplified using the primers OmpPst2_F4qs (5’-ATTATTCGCGGCGGGTGTTAC-3’) and OmpPst2_R4qs (5’-CAGCGGCCATATTCTTGTTGA-3’) using the Q5 High-Fidelity DNA Polymerase (New England BioLabs). The PCR program consisted in an initial step at 98°C for 5 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Microbiology 2023Quote: ... PM (5’-GACCCCGTTGACAGCG-3’) and PMrev (5’-TGGAACACCTGGCGGAAA-3’) with T4 polynucleotide kinase (0.075 U/µL) (New England Biolabs) and [g32P]-ATP (3000 Ci/mmol ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries were generated from a total amount of 3 μg RNA per sample using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and a maltose binding protein (MBP) (65) and Factor Xa sequence derived from pMAL-c5X vector (New England Biolabs, Ipswich, MA) with a V313A mutation to be consistent with the native E ...
-
bioRxiv - Cell Biology 2022Quote: ... which was incorporated into the TMD by amber stop codon suppression in the PURExpress system lacking all release factors (ΔRF123; New England Biolabs, USA). The release factors RF2 and RF3 ...
-
bioRxiv - Cell Biology 2020Quote: ... Renilla luciferase was PCR amplified from pMT-DEST48-FLP 31 with Renilla Luciferase Forward: 5’-TGGAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGACTTCGAAAGTTTATG-3’ and Renilla Luciferase Reverse: 5’-TGGAAGCTTTTATTATTGTTCATTTTTGAGAAC-3’ and digested with HindIII (NEB). Renilla luciferase was then ligated into pGL3-Control digested HindIII (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
bioRxiv - Immunology 2022Quote: ... and we digested up to 3 μg of DNA with 3 μl of EcoRI-HF restriction enzyme (New England Biolabs) per 50 μl.