Labshake search
Citations for New England Biolabs :
101 - 150 of 10000+ citations for Human Complement Component 1 Q Subcomponent Binding Protein HABP1 C1QBP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... for the substrate-binding domain mutants and βamHI-AlwnI (NEB) for the transmembrane domain mutants (Appendix) ...
-
bioRxiv - Genomics 2022Quote: ... Nascent RNA was purified by binding streptavidin beads (NEB S1421S) and washed as described by Mahat et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-4-points were induced in the miR-29a seed binding site using the Q5 Site Directed Mutagenesis Kit (NEB, Cat#E0554S). 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... of full-length SEC16A were generated by mutating 10 nucleotides in the silencer-select Sec16A siRNA (5’-CGGAGCUUCUGUUACGAGATT-3’, siRNA id: s19236, Thermo-Fischer Scientific) binding site using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) following manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2021Quote: ... pFastBac dual vector containing the sequence for the N-terminally 6xHis-tagged human Naa15 and truncated human Naa10 (residues 1-160) sequences was digested using KpnI-HF (NEB) and XmaI (NEB ...
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... Human FBP1 mutants were constructed by Q5 Site-Directed Mutagenesis Kit (NEB, E0554S) in the PCDH-V5-FBP1 vectors ...
-
bioRxiv - Molecular Biology 2019Quote: ... an RNA-protein complex was formed with 1 µM Cas9 protein (New England Biolabs) and 1 µM gRNA pool (3 gRNAs in total ...
-
bioRxiv - Synthetic Biology 2021Quote: ... carrying all remaining components in a Golden Gate reaction performed as described above but with Esp3I (10,000 U/mL, NEB) instead of BsaI ...
-
bioRxiv - Molecular Biology 2019Quote: ... The samples were then transferred on to the ice and the components (15 μl Blunt ligase master mix, 2.5 μl NEB Next adaptor for Illumina ...
-
bioRxiv - Genetics 2023Quote: ... 100 pmol of template oligos and 125 pmol IRDye 700-labeled reverse complement primer F1 were mixed in Phusion® High-Fidelity PCR Master Mix (NEB, Ipswich, MA). A 15s denaturing at 95°C following a 10-minute extension at 52°C afforded duplex DNAs ...
-
bioRxiv - Synthetic Biology 2019Quote: The PURExpress in vitro protein synthesis kit (New England BioLabs) was used to transcribe and translate Were-1-Fluc ...
-
bioRxiv - Microbiology 2022Quote: Experiments with PURExpress in vitro protein synthesis kit (NEB, E6800) were performed as per the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: We used PURExpress In Vitro Protein Synthesis Kit (NEB, E6800L) and the reaction was set up with the following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... the PURExpress In Vitro Protein Synthesis Kit (New England Biolabs) was used to translate the synthetic transcriptome described above ...
-
bioRxiv - Microbiology 2023Quote: ... proteins were removed using the Monarch RNA Cleanup Kit (NEB) and 5’-mono-phosphorylated v51_mut_S templates were specifically digested with a terminator 5’-phosphate-dependent exonuclease (Biosearch technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... kit and co-injected with Cas9 protein (New England Biolabs) into one-cell stage zebrafish eggs ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... 400 units mL-1 lambda protein phosphatase (NEB), and 0.1 μg mL-1 protein phosphatase 2a (Cayman Chemical ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared using the NEBNext Immune Sequencing Kit for Human (New England Biolabs) according to the manufacturer’s instructions without modifications ...
-
bioRxiv - Plant Biology 2021Quote: ... pGEMT-Q-satRNAWT was linearized by NcoI (New England Biolabs) and subject to in vitro transcription using SP6 MAXIscript kit.
-
bioRxiv - Microbiology 2021Quote: ... The URA3 and 2μ components were amplified from pYES2 using primers (actatagcagcggaggggttggatcaaagtcttcctttttcaatgggtaataactga and caaccacagggttcccctcgggatcaaagtacaatcttcctgtttttggggc) using Phusion DNA polymerase (New England Biolabs) with annealing at 63°C and a 2 minute extension ...
-
bioRxiv - Microbiology 2020Quote: ... the V1-V3 region of 16S rRNA genes was amplified from 2 ng of DNA in 50 μl reactions containing the following components: 1x Standard Taq Reaction Buffer (NEB), 3 mM MgCl2 (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... put on ice for 5 min and the following components were added in the specified order: 1x capping buffer (NEB), 0.5 mM GTP ...
-
bioRxiv - Synthetic Biology 2021Quote: An aqueous mixture comprising all of the components for a RCA reaction was prepared to include: 1X Phi29 buffer (New England Biolabs), which has 50 mM Tris-HCl at pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... such that the final concentration of components in the 20 μl PCR were: 1X Q5 Reaction Buffer (New England Biolabs), 1X Q5 High GC Enhancer (New England Biolabs) ...
-
bioRxiv - Biochemistry 2020Quote: ... Human β2AR was fused at its N-terminus to the ACP- or Halo7-tag protein (NEB and Promega, respectively) at the cDNA level ...
-
bioRxiv - Molecular Biology 2019Quote: Libraries were prepared with NEBNEXT rRNA Depletion kit (human/mouse/rat) and NEBNEXT Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: IVPS was performed using PURExpress In Vitro Protein Synthesis Kit (NEB) with supplements (16 U RNase inhibitor (NEB) ...
-
bioRxiv - Microbiology 2023Quote: The PURExpress ΔRibosome In Vitro Protein Synthesis Kit (New England Biolabs) was used for in vitro translation assays ...
-
bioRxiv - Cell Biology 2023Quote: ... and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs, 5 U μg-1 of protein) were added with gentle mixing after each addition ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μL of Lambda Protein Phosphatase (New England Biolabs) or 1 μL of phosphatase inhibitor mix (20 mM β-glycerophosphate ...
-
bioRxiv - Cell Biology 2021Quote: ... HRP-conjugated antibody binding was detected using TMB substrate (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... depleted with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat, NEB, Figures 6 and S6), or not depleted (Figures 2B ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: DNA from human cells was isolated using the Monarch®Genomic DNA Purification Kit (NEB) following the manufacturer’s instructions and including the recommended RNaseA digestion step ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: RNA from human cells was isolated using the Monarch®Total RNA Miniprep Kit (NEB) following the manufacturer’s instructions and including the on-column DnaseI digestion ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat; NEB, E6310X). rRNA-depleted RNA was converted to a library using NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Bioengineering 2022Quote: ... Genes encoding individual components of biosensors were amplified by polymerase chain reaction (PCR) using Q5® High-Fidelity DNA Polymerase (New England Biolabs). Site-directed mutagenesis was performed by QuikChange lightning mutagenesis kit (Agilent ...
-
bioRxiv - Synthetic Biology 2023Quote: ... reaction was performed to remove sfGFP and replace it with the cassette components (P1-FLAG, P2-Substrate, P3-HA, P4-ERS). This plasmid was transformed into competent Escherichia coli (E. coli) (NEB#C2984H), purified (QIAGEN #27106 ...
-
bioRxiv - Molecular Biology 2022Quote: The coding sequence of the BTB domain of selected ZBTB family proteins was amplified from cDNA derived from the human HCT116 cell line using Q5 High-Fidelity DNA Polymerase (NEB). Specifically for the Patz1 construct ...
-
bioRxiv - Biochemistry 2019Quote: Wild-type and mutant human FICD proteins (aa 104-445) were expressed as His6-Smt3 fusion constructs in T7 Express lysY/Iq (NEB) E ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were analysed by an MSD Elisa assay (Pacific Biolabs) using a CEP55 antibody (Novux ...
-
bioRxiv - Microbiology 2022Quote: ... the PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs, E6800L) was used as described in the instructions with minor modifications ...
-
bioRxiv - Microbiology 2023Quote: ... the PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs, E6800L) was used as described previously (31) ...
-
bioRxiv - Cancer Biology 2023Quote: ... library was prepared using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA). The RNA-Seq libraries were sequenced on NextSeq 500 using the NextSeq 500/550 High Output Kit v2.5 (75 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... The components of the construct were joined using the Gibson Assembly method (NEBuilder HiFi DNA Assembly Master Mix, New England Biolabs, MA, USA), resulting in the dTomato gene under the control of several lengths of the promoter of lpmA (plasmids pRO311 ...
-
bioRxiv - Genetics 2020Quote: ... A length of 250 nt immediately preceding LdNT4 translation start was amplified from genomic DNA and both components were assembled via the Gibson Assembly method using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs, Ipswitch, MA).
-
bioRxiv - Synthetic Biology 2023Quote: ... The expression of each engineered component was validated pre- and post-sort by staining Jurkat cells with an anti-Myc antibody (#2233S, NEB, MA, USA), followed by performing flow cytometry on a FACSCanto (BD Biosciences) ...
-
bioRxiv - Genomics 2019Quote: ... After two washes in binding buffer and one wash in ligation buffer (NEB), PE adapters (Illumina ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The backbone was cut upstream of the binding site array using BglII (NEB) and in the YB_TATA minimal promoter using SpeI-HF (NEB) ...