Labshake search
Citations for New England Biolabs :
51 - 100 of 10000+ citations for Human Complement Component 1 Q Subcomponent Binding Protein HABP1 C1QBP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... The HDR templates were mixed at fourfold molar excess with a single-strand DNA binding protein (ET SSB, NEB, M2401S) and heated at 95°C for 10 minutes to achieve singlestranded donor oligonucleotides (ssODNs ...
-
bioRxiv - Neuroscience 2022Quote: ... 100 cells were isolated directly into low protein binding eppendorfs containing 2 ul NEBNext Single Cell Lysis Buffer (NEB, E5530S). Samples were kept on dry ice until transfer to −80 C for overnight storage.
-
bioRxiv - Biochemistry 2022Quote: ... and LaTR were fused to the C-terminus of the maltose binding protein (MBP) in the pMAL-c2x vector (New England Biolabs). Precisely ...
-
bioRxiv - Genetics 2022Quote: ... We inserted TFT reporters into BFA0190 by digesting the plasmid with SwaI and inserting TFT components between the LYP1 flanking sequences using isothermal assembly cloning (Hifi Assembly Cloning Kit; New England Biolabs [NEB], Ipswich, MA, USA). The 5’ and 3’ LYP1 flanking sequences in each TFT plasmid contain natural SacI and BglII restriction sites ...
-
bioRxiv - Developmental Biology 2021Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and a maltose binding protein (MBP) (65) and Factor Xa sequence derived from pMAL-c5X vector (New England Biolabs, Ipswich, MA) with a V313A mutation to be consistent with the native E ...
-
bioRxiv - Systems Biology 2020Quote: ... reaction components were added for second strand synthesis (70 μL water, 20 μL NEB second strand buffer ...
-
bioRxiv - Genetics 2021Quote: ... All components were combined using a Gibson assembly reaction (New England Biolabs ref # E2611L) following the manufacturer’s protocol and transformed into XL1 blue competent cells ...
-
bioRxiv - Systems Biology 2023Quote: ... All components were ligated together using NEB T4 Ligase (New England Biolabs, Ipswitch, MA) according to the manufacturers protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 µl 10x BSA (diluted 1:10 with Milli-Q water from a 100X stock, New England Biolabs), and 1 µl of each enzyme used as described in Fig ...
-
bioRxiv - Bioengineering 2020Quote: ... protease mutant S219V [24] was inserted at the 3’ end of gene encoding maltose binding protein (MBP) in pMAL-c5E vector (New England Biolabs, MA, USA) to construct pMAL-TEV vector ...
-
bioRxiv - Bioengineering 2023Quote: ... the AsCas12a-crRNA complexes were combined with 1 µL of binding buffer (New England BioLabs, #B6002S), 4.5 µL of biotinylated quencher probes ...
-
bioRxiv - Cell Biology 2020Quote: ... The FER1 Ca2+-binding mutants in the C2D domain were generated by Q5 site directed mutagenesis kit (NEB) using primers 4833/4834 to change positions A1622 and A1634 to C resulting in Asp codon 542 and 545 changes to Ala.
-
bioRxiv - Biochemistry 2024Quote: The ATP binding mutants (APLFD11A, APLFR37A, APLFK95A) were generated using Q5® Site- Directed Mutagenesis Kit (NEB #E0554) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2020Quote: The following components comprised the RT-LAMP assay: 4 mM of MgSO4 (New England Biolabs), 1× final concentration of the isothermal amplification buffer (New England Biolabs) ...
-
bioRxiv - Biophysics 2020Quote: ... FR-Q and FR-MQ were made using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) with pBad-FR and pBad-FR-M ...
-
bioRxiv - Microbiology 2019Quote: ... we performed q-RT PCR using the Luna Universal One-Step RT-qPCR Kit from NEB (E3005), using the Applied BiosystemsΤΜ 7500 Real-Time PCR system ...
-
bioRxiv - Neuroscience 2023Quote: ... After quantification of individual libraries by q-PCR using the NEBNext library quant kit (New England BioLabs), all the samples were pooled in an equimolar manner ...
-
bioRxiv - Microbiology 2020Quote: ... and a “bottom” strand with sequence 5’-AAAAC-(30bp spacer reverse complement)-3’ were phosphorylated with PNK (NEB, M0201S) in a 50 μL reaction volume (1.5 μL 100 uM top oligo ...
-
bioRxiv - Cancer Biology 2020Quote: ... The synthetic genes encoding WT human TRIM28 with an N-terminal maltose binding protein (MBP) affinity tag (UniProt: Q13263) were subcloned to the pMAL-p2X vector (New England Biolabs, Beverly, MA, USA).
-
bioRxiv - Cell Biology 2023Quote: ... corresponding to a portion of PfRNF1 (RP2; Fig. 1A) was expressed as a maltose-binding fusion protein using the pMAL™c5X-vector (New England Biolabs, Ipswich, USA). To this end ...
-
bioRxiv - Genomics 2022Quote: ... A first binding to streptavidin beads (NEB, S1421S) and washed as described (24) ...
-
bioRxiv - Microbiology 2020Quote: Mutations within the stem-loop binding site of SHOxi were constructed using the Q5 Site-directed Mutagenesis kit (NEB) standard protocol on the previously described SHOxi overexpression construct (in pTA1300) ...
-
bioRxiv - Neuroscience 2024Quote: Blood corticosterone levels were measured using the Mouse corticosterone Enzyme-linked immunosorbent assay (ELISA) kit (BIOLABS, USA) by collecting blood from wild-type mice ...
-
bioRxiv - Genomics 2019Quote: ... then incubated with 16 µg of TET2 enzyme (EM-seq component E7130A, NEB, Ipswich MA, USA) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids for the trans-Tango components were generated using the Hi-Fi DNA Assembly (NEB #E5520S), BP Gateway Cloning (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was then subjected to a primer extension reaction with dUTP to separate the nascent strand from its complement (1X NEB buffer2 ...
-
bioRxiv - Genomics 2022Quote: ... pJR98 was digested by AscI and ssDNA oligo donors of the sequence 5’ CTCTTCCTGCCCGACCTTGGGG – reverse complement IBC – CAGCGCCATAGCTGAGTGTAGATTCGAGC – 3’ were cloned into the vector using NEBuilder HiFI DNA Assembly Master Mix (NEB). Third ...
-
bioRxiv - Microbiology 2023Quote: ... and complement strains (wos2Δ::WOS2) were constructed using biolistic transformation of constructs amplified using double-joint PCR or Gibson Assembly (NEB), as previously described (primers ...
-
bioRxiv - Synthetic Biology 2023Quote: Protein expression was performed with the PURExpress In Vitro Protein Synthesis kit (E6800, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Lactis Protein Expression kit (New England Biolabs, UK) was used with the pKLAC2 vector ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 chimeras containing the TM domains from either human MARCH4 or human transferrin receptor (TR) were generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) and the primers listed in Supplemental Table S2 ...
-
bioRxiv - Neuroscience 2022Quote: ... Mutation of the verified 7-mer binding site of the 3’-UTR of Zfp36l1 was performed using the Q5-site directed mutagenesis kit (New England BioLabs) using the following primers ...
-
bioRxiv - Genetics 2023Quote: The site directed mutagenesis of the rbsD gene to introduce the stop codon and the mutated dsrA binding sites was carried out using the Q5 mutagenesis kit (New England Biolabs) and selection on kanamycin plates ...
-
bioRxiv - Microbiology 2024Quote: To test the binding affinity of the TBT and TBTG mRNA to the 30S ribosomal subunit we used PURExpress ΔRibosome Kit (NEB) supplemented with 5 μM of 30S ribosomal subunit and 10 μM tRNAfMet in the presence of 1.4 μM of radioactively labelled mRNA (prepared as described above by in vitro translation followed by [32P] labelling as described for the northern blot probe labelling) ...
-
bioRxiv - Genomics 2021Quote: ... RNA binding with streptavidin beads (NEB, Ipswich, MA; S1421) followed by RNA extraction with Trizol ...
-
bioRxiv - Genomics 2022Quote: ... RNA binding with streptavidin beads (NEB, Ipswich, MA; S1421) followed by RNA extraction with Trizol ...
-
bioRxiv - Biochemistry 2022Quote: ... with recombinant proteins (200-500 ng) and yeast purified CK2 or recombinant human CK2 (NEB, P6010S). Proteins were resolved by SDS-PAGE and the gels were exposed to autoradiography or stained with Coomassie blue.
-
bioRxiv - Genomics 2019Quote: ... and deaminated with 100 U of APOBEC3A (EM-seq components E7133AA and E7134AA NEB, Ipswich, MA, USA) in 100 µl reaction volume for 3 h ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of human recombinant histone H4 (BioLabs, Cat# M2504S) was incubated with 50 μM n-butyryl- or isobutyryl-CoA and 0.2 μM of HAT1 at 30 °C for 1 hour ...
-
bioRxiv - Neuroscience 2022Quote: ... or the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB) (replicates 4-5 and no salt treatment ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Genetics 2023Quote: ... using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB E7405) or the NEBNext Poly(A ...
-
bioRxiv - Cell Biology 2020Quote: Three point mutations in the predicted miR-145 seed binding site in DUSP6 were introduced in pGEM-T-DUSP6 3’UTR using a Phusion® site-directed mutagenesis kit (NEB) and the mutagenic primers ...
-
bioRxiv - Molecular Biology 2021Quote: Site-directed mutagenesis of the AP-1 binding sites in the distal enhancer reporter plasmids were performed using the Q5® Site-Directed Mutagenesis Kit (New England BioLabs). Primer pairs 5’-CCATAATGTGgggCTATACTAAATTTCATCTTC-3’ and 5’-CTAAATCCACTTAGAAAAAACAATC-3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... C terminal and αPKC binding region) or PICK1 (BAR domain) were made with NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520S). Mutations of PICK1 (KD-AA and 5K-E ...
-
bioRxiv - Cell Biology 2022Quote: ... Tracheal chitin was stained with 505 star conjugated chitin-binding probe (NEB, Frankfurt/M, Germany, used at 1:300). Nuclei were stained with 4’,6-Diamidino-2-Phenylindole ...
-
bioRxiv - Cell Biology 2019Quote: ... The pTATi1-TetO7Sag4 vector backbone was constructed from a four-component HiFi assembly (Cat# E5520, New England Biolabs): 1 ...
-
bioRxiv - Genomics 2020Quote: ... Nascent RNA was purified by binding streptavidin beads (NEB, S1421S) before and in between the following procedures ...