Labshake search
Citations for New England Biolabs :
101 - 150 of 208 citations for FITC labeled Fibrinogen since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Receptors were surface labeled by addition of SNAP-Surface Alexa Fluor 546 (1:1000, New England Biolabs) to DMEM F12 without serum and phenol red (21041-025 ...
-
bioRxiv - Molecular Biology 2022Quote: miRNAs were synthesized by IDT and radio-labeled at the 5’ end with T4 polynucleotide kinase (NEB) and (γ-32P ...
-
bioRxiv - Microbiology 2022Quote: ... The glpFKD promoter fragments were labeled with 32P using DNA Polymerase I Large Fragment (Klenow fragment) (NEB) to fill in the 5’ overhang with [α-32P]dATP ...
-
bioRxiv - Developmental Biology 2023Quote: ... Digoxigenin-labeled antisense Alk3 RNA probe was prepared by linearization with EcoR1 (New England Biolabs, Ipswich, MA) and transcription with T7 RNA polymerase (Promega ...
-
bioRxiv - Cell Biology 2024Quote: ... the H3.1-SNAP and H3.3-SNAP were labeled with SNAP-Cell 505-Star (New England Biolabs, S9103S) for a duration of 30 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... 400 ng of eluted DNA fragments were end-labeled with T4 Polynucleotide Kinase (T4 PNK) (NEB M0201L) and 10 μCi of [γ−32P]-ATP for 1 hour at 37 C ...
-
bioRxiv - Biophysics 2024Quote: ... A 673 bp digoxigenin-labeled DNA handle was amplified in Q5U PCR master mix (NEB, Cat# M0597L) with a forward primer containing a deoxyuridine and a reverse primer with a 5′ digoxigenin tag ...
-
bioRxiv - Biochemistry 2024Quote: Cy3-labeled enhancer-promoter DNAs used for condensation assay were generated by PCR using Taq polymerase (NEB) with a Cy3-labeled primer (IDT ...
-
bioRxiv - Genomics 2024Quote: ... Digested DNA fragments were filled in with biotin-labeled dATP by incubating with Klenow enzyme (NEB, M0212), biotin-14-dATP (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA was then 5’ end labeled in 24μL PNK wash buffer with 16μL of 1x PNK buffer (NEB) containing 150μCi of gamma P32-ATP ...
-
bioRxiv - Biochemistry 2022Quote: 3’-PUA-DNA was generated by incubation of 1 μM 5’-FAM-labeled AP-DNA (FAM_U_35) with 20 U EndoIII/Nth (NEB) in Buffer B pH 7.0 at 37 °C for 60 m ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... was detected by addition of 1 nM Europium-labeled anti-p53 phosphoserine 15 antibody (New England Biolabs/ Cisbio) and 40 nM streptavidin-conjugated APC (Prozyme ...
-
bioRxiv - Immunology 2020Quote: SNAP-ASC-CARD and CASP1-CARD-SNAP monomers that were labeled with Alexa Fluor 647 (New England Biolabs) were co-incubated with CARD domain only filament seeds (CARD8-CARD without SNAP ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA probes (Extended Table 1) at 500 nM were 5’-[32P]-labeled using T4 Polynucleotide Kinase (NEB) and hybridized to the membrane overnight at 37°C in PerfectHyb™ Plus Hybridization Buffer (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... this extension could be radioactively labeled by filling in the overhangs using 32P-dCTP and Klenow enzyme (NEB). Sequences of the +-strand oligonucleotides used are described in Table 1.
-
bioRxiv - Cell Biology 2023Quote: ... Snap-tagged human β1AR and β2AR constructs were labeled with Snap-cell 647 SiR (New England Biolabs, S9102S) at 1:1000 concentration for 20 min at 37°C in DMEM without phenol red supplemented with 30 mM HEPES ...
-
bioRxiv - Cell Biology 2023Quote: ... A stock solution of these oligos (1μl of a 10μM) was 5’-end-labeled using T4PNK (NEB®) and 5μl of ATP ...
-
bioRxiv - Microbiology 2024Quote: ... resuspended in 100 µL of supernatant and labeled by incubation with SNAP-cell TMR-Star (New England Biolabs) at a final concentration of 250 nM for 30 min at 37 °C in the dark ...
-
bioRxiv - Biophysics 2024Quote: ... We labeled Nup96-SNAP with SNAP-tag ligand O6-benzylguanine conjugated AF647 (BG-AF647, S9136S, New England Biolabs) as described else (26) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 15 pmol of annealed oligos were end-labeled using γ32P-ATP and T4 Polynucleotide kinase (New England Biolabs) for 1 h at 370C ...
-
bioRxiv - Cell Biology 2024Quote: ... and the SNAP-tag of Atg16 for Figure 5E was labeled with SNAP-Surface 647 (New England BioLabs), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris-PAGE ...
-
bioRxiv - Biochemistry 2021Quote: ... S121A or triple mutant (AAA)) was incubated and labeled in vitro with 2U of CK2 (New England Biolabs, P60105) in a 30µl reaction containing 3pM adenosine triphosphate (ATP) ...
-
bioRxiv - Biophysics 2021Quote: ... All proteins were purified and labeled with BG-surface Alexa 647 and BC-surface Dy547 dyes (New England Biolabs) as previously described (Murayama and Uhlmann ...
-
bioRxiv - Microbiology 2022Quote: ... Oligonucleotides complimentary to the target were end-labeled with γ-32P-ATP by T4 polynucleotide kinase (New England Biolabs). Labeled oligonucleotides were added to the membrane and incubated overnight at 45°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris-PAGE and transferred to a nitrocellulose membrane (Protran) ...
-
bioRxiv - Genetics 2020Quote: ... Open chromatin DNA was labeled with biotin by incubating the nuclei in presence of 2.5 U of Nt.CviPII (NEB, R0626S), 50 U of DNA polymerase I (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... Oligonucleotide probe for telomere or Alu repeats was labeled with [32P]-ATP (3,000 Ci/mmol) and T4 nucleotide kinase (New England Biolabs). The membrane was hybridized in Church hybridization buffer containing a 32P-labeled probe at 42°C overnight ...
-
bioRxiv - Biophysics 2023Quote: RNAs were labeled with γ32P-ATP using T4 polynucleotide kinase (PNK) according to the manufacturer conditions (New England Biolabs). Radioactive RNAs were separated from any non-incorporated γ32P-ATP via denaturing 15% polyacrylamide (19:1 ...
-
bioRxiv - Genomics 2023Quote: ... cells in the latter plate were labeled with HaloTag Oregon Green and SNAP-Cell 647-SiR (New England Biolabs) simultaneously according to the manufacturers’ protocols ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was labeled by fill-in of EcoRI overhangs with the DNA polymerase I Klenow fragment (New England Biolabs) in the presence of [α-32P] dATP (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2023Quote: Isotope labeled firefly luciferase (Fluc) mRNA was synthesized by HiScribe T7 High Yield RNA Synthesis Kit (E2040S, NEB, Ipswich) using stable heavy isotopes of ATP and CTP (NLM-3987-CA and CNLM-4267-CA-20 ...
-
bioRxiv - Biophysics 2023Quote: ... We then sequentially labeled Nup96 proteins with SNAP ligand conjugated Alexa Fluor 647 (BG-AF647, S9136S, New England Biolabs) and mitochondria with primary anti-Tomm20 antibodies (rabbit polyclonal ...
-
bioRxiv - Cancer Biology 2022Quote: ... new SNAP-tagged histones were pulse-labeled for 30 min with 5 μM final SNAP-biotin (New England Biolabs) diluted 1:200 in 10% Duolink blocking buffer (Sigma-Aldrich ...
-
Recruitment of the m6A/Am demethylase FTO to target RNAs by the telomeric zinc finger protein ZBTB48bioRxiv - Molecular Biology 2024Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L). Protein-RNA complexes were separated using 4–12% BisTris–PAGE and transferred to a nitrocellulose membrane (Protran) ...
-
Recruitment of the m6A/Am demethylase FTO to target RNAs by the telomeric zinc finger protein ZBTB48bioRxiv - Molecular Biology 2024Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris–PAGE and transferred to a nitrocellulose membrane (Protran) ...
-
bioRxiv - Microbiology 2024Quote: ... 100 pmol of POWV_Probe and U6_probe DNA probes were radioactively labeled with 5mCi of [γ32-P] ATP using T4 polynucleotide kinase (NEB) for 2 hours at 37°C ...
-
bioRxiv - Genomics 2024Quote: M13seq primer (5’-GACGTTGTAAAACGACGGC-3’) was labeled with 32P at 5’-end by T4 polynucleotide kinase (New England Biolabs). Primer/template (p/t ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 µg of pUC19 was cleaved with EcoRI and labeled at the 5′ ends using T4 polynucleotide kinase (NEB) with [γ-32P]-ATP or at the 3′ ends using Klenow (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... SNAP-fused proteins in the extract were then labeled by incubation with 0.4 μM SNAP-Surface-549 (New England Biolabs) for 1 hour at 4°C on a rotator ...
-
bioRxiv - Microbiology 2022Quote: ... the membranes were hybridized overnight with antisense oligo probes listed in the S6 Table end-labeled with T4-PNK (New England Biolabs) using 32P-γ-ATP (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The SNAP-tagged histones neosynthesized during the chase time were pulse-labeled by incubating cells with 2 μM of red-fluorescent SNAP reagent (SNAPcell TMR star, New England Biolabs) for 15 min at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... was dephosphorylated and 5’ end labeled with P32 as follows: 25 pmol of RNA was dephosphorylated using 50U of Antarctic Phosphatase (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... One of the strands of each sequence was then labeled with P32 as follows: 10 pmols of single stranded DNA was incubated with 5 Units of T4 PNK (NEB) and 0.64µCi of P32- γ -ATP (Perkin-Elmer ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA-protein complexes were radioactively labeled with 32P-γ-ATP (20 μCi) using 40U T4 Polynucleotide Kinase (New England Biolabs) in supplied PNK buffer for 30 min at 37ºC ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The splicing isoforms were then amplified with minigene-specific primers (F: CTGGCTAACTAGAGAACCCACTGC; R: GGCAACTAGAAGGCACAGTCG) and 32P-labeled dCTP using Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer′s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... pJET1.2 plasmids containing 150 bp FCR monomer sequences were PCR-amplified and fluorescently labeled using random hexamer priming and Klenow (exo-) polymerase (New England Biolabs). Both Alexa Fluor 488 and 568 dUTP-conjugated fluorophores were used ...
-
bioRxiv - Molecular Biology 2020Quote: Gene-specific primers (Supplementary Table 4) were labeled with [γ-32P]ATP by phage T4 polynucleotide kinase (New England Biolabs), as recommended by the manufacturer ...
-
bioRxiv - Immunology 2020Quote: ... A 32P-labeled 368 nt transcript was generated from EcoRI digested probe temple (described below) using T7 RNA polymerase (New England Biolabs). The probe was diluted in the hybridization buffer described above ...
-
bioRxiv - Zoology 2020Quote: ... Each gel also contained 32P-end-labeled size ladders (Molecular Weigh Marker XV, by Roche Diagnostics and 1Kb DNA ladder by New England Biolabs). After electrophoresis ...