Labshake search
Citations for New England Biolabs :
1 - 50 of 208 citations for FITC labeled Fibrinogen since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Differential impact of a dyskeratosis congenita mutation in TPP1 on mouse hematopoiesis and germlinebioRxiv - Cell Biology 2021Quote: ... 5′ 32P-labeled (TTAGGG)4 oligonucleotide (labeled using [γ-32P]ATP and T4 PNK; New England Biolabs) was added ...
-
bioRxiv - Microbiology 2021Quote: ... or radio-labeled Msp1-digested pBR322 (NEB). Membranes were hybridized with complementary RNA probes ...
-
bioRxiv - Biophysics 2022Quote: Open complexes were pre-formed by incubating an excess of RNAP holoenzyme (>1.7 nM active) with <400 pM γ-32P-labeled promoter DNA (labeled with T4 polynucleotide kinase from NEB) in BB at 37 °C for at least 30 min ...
-
bioRxiv - Biochemistry 2024Quote: ... When relevant cmpRNA (500 pmol) was 5’-end phosphate-32 “hot” labeled using fresh gamma phosphate-32 labeled ATP (50 nmol) and PNK (NEB) following the producer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... radioactively labeled using Klenow fragment (New England Biolabs) and [α-32P]dCTP ...
-
bioRxiv - Microbiology 2022Quote: ... and end- labeled using T4 polynucleotide kinase (NEB) with [γ-32P] ATP (Perkin Elmer) ...
-
Adaptive translational pausing is a hallmark of the cellular response to severe environmental stressbioRxiv - Molecular Biology 2020Quote: ... Probe was labeled with T4 PNK (NEB M0201S) at 37°C for 1 h in a reaction containing 20 pmol probe ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide was 5’-labeled using PNK enzyme (NEB). The ITS2 probe was previously reported (Donati et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA Probes were labeled with DIG (New England Biolabs) or DNP-11-UTP (Perkin Elmer ...
-
bioRxiv - Genomics 2020Quote: ... Biotin labeled dATP (Thermo,19524016) and Klenow (NEB, M0210) were used to fill restriction fragment overhangs ...
-
DDK regulates replication initiation by controlling the multiplicity of Cdc45-GINS binding to Mcm2-7bioRxiv - Cell Biology 2020Quote: ... the FLAG eluate was labeled with SNAP-Surface549 (NEB) by incubating 3x molar excess of dye at 4°C overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5’ end-labeled using T4 polynucleotide kinase (NEB) and [γ-32P] ATP ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1M cells were labeled with SNAP-Surface 647 (NEB) following manufacturer’s recommendation (50 μM concentration of SNAP-Surface 647 in complete cell media ...
-
bioRxiv - Developmental Biology 2023Quote: ... and end-labeled using T4 polynucleotide kinase (M0201, NEB) and [γ-32P] ATP (NEG002A250UC ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA probes were labeled with T4 PNK (NEB, M0201S) and [γ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Telomere probe was labeled using T4 polynucleotide kinase (NEB M0201) and <ι>γ-P32-ATP (Perkin Elmer NEG035C ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were pulse-labeled with SNAPcell-505 (1 µM; NEB) for 20 min in media ...
-
bioRxiv - Biochemistry 2022Quote: ... and labeled with [γ-32P]ATP by T4 PNK (NEB), followed by gel purification ...
-
bioRxiv - Cell Biology 2023Quote: ... and 7SK (GTGTCTGGAGTCTTGGAAGC) were radioactively labeled using T4 PNK (NEB) and ∼10x106 cpm of each probe were added to the membrane ...
-
bioRxiv - Cancer Biology 2021Quote: ... Northern probes were labeled with 32P ATP with T4 PNK (NEB), purified with a G25 column (GE Healthcare) ...
-
bioRxiv - Cell Biology 2021Quote: ... and labeled with SNAP-Cell TMR-Star (New England Biolabs, S9105S) or SNAP-Cell 647-SiR (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was labeled with gamma-32P-ATP using T4 PNK (NEB). After washing with PNK buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The probes were labeled using T4 polynucleotide kinase (New England BioLabs) and [γ-32P] ATP (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The labeled oligonucleotide (∼5 pmol) was treated with uracil glycosylase (NEB) in 1x UDG buffer (20 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2022Quote: ... the substrates used are 5’-end-labeled with T4 PNK (NEB) in the presence of gamma 32P-ATP ...
-
bioRxiv - Cancer Biology 2023Quote: ... Northern probes were labeled with 32P ATP with T4 PNK (NEB) and purified with a G25 column (GE healthcare) ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA oligonucleotides were labeled in 3’ using poly(U) polymerase (NEB) and [α-32P]UTP ...
-
bioRxiv - Cell Biology 2020Quote: ... and then labeled with SNAP-surface-549 (New England Biolabs, Ipswich, MA) overnight at 4°C following the manufacturers’ protocols ...
-
bioRxiv - Microbiology 2021Quote: ... Dephosphorylated RNA was then 5’ end-labeled with 20U T4 PNK (NEB) and 30μCi [g32-P]ATP (Perkin-Elmer) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were labeled with 500nM SNAP-Surface 649 (New England Biolabs, #S9159S) for 5 minutes at 37°C for TIR-FM imaging or 1μM permeable SNAP-Cell 647-SiR (New England Biolabs ...
-
bioRxiv - Immunology 2020Quote: ... The enriched Br-dU labeled RNAs were incubated with RppH (NEB, #M0356S) and with T4 PNK (NEB ...
-
bioRxiv - Bioengineering 2020Quote: ... Probes were labeled with ATP-P32 using T4 polynucleotide kinase (NEB®) and blot was exposed to a phosphor screen (GE® ...
-
bioRxiv - Immunology 2020Quote: ... The enriched Br-dU labeled RNAs were incubated with RppH (NEB, #M0356S) and with T4 PNK (NEB ...
-
bioRxiv - Genomics 2023Quote: ... Probes were labeled with 32P by nick translation (New England Biolabs, Inc.) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... dinucleotide primers were 5’-labeled using T4 polynucleotide kinase (New England Biolabs) and added at 20 µM without pre-annealing to the template ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... transfected cells were labeled with SNAP-Surface Alexa Fluor 647 dye (NEB) as described earlier ...
-
bioRxiv - Cell Biology 2020Quote: ... PLCγ1 nSH2-cSH2-SH3 and truncations were labeled with CoA 647 (NEB, S9350) via an N-terminal ybbR tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAs were 5′-labeled with 32P-γ-ATP using T4 polynucleotide kinase (NEB) and purified on P-30 spin columns (Bio-Rad) ...
-
bioRxiv - Biophysics 2021Quote: ... A dT50 oligo was radioactively labeled with 32P by T4 PNK (NEB M0201). EMSAs were performed in Imaging Buffer at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: DNA or RNA was labeled at 5′-termini with T4-Polynucleotide kinase (NEB) using ψ-P32-ATP as indicated in Figure 2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the ir800 labeled RNA linker was ligated on using RNA Ligase I (NEB), and 0.5uM of pre-adenylated adapter as previously published73 ...
-
bioRxiv - Cell Biology 2024Quote: ... and Atg38 were labeled with SNAP-Surface Alexa Fluor 488 (New England BioLabs), the SNAP-tag of Atg13 was labeled with SNAP-Surface 549 (New England BioLabs) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Digested fragments were biotin-labeled and subsequently ligated by T4 DNA ligase buffer (NEB) for 2 hours at 23°C with 300 rpm gentle rotation ...
-
bioRxiv - Cell Biology 2021Quote: ... dynein-coated beads were labeled with 5 µM SNAP-Cell-TMR (New England Biolabs) in the column for 10 min at room temperature and unbound dye was removed with a 300 mL wash with TEV buffer at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: The full-length PLCγ1 was labeled with SNAP-Surface Alexa Fluor 647 (NEB, S9136S). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... Fragments were then end-labeled with γ-32P-ATP using T4 polynucleotide kinase (NEB), separated on 15% TBE-Urea gels and visualized by autoradiography ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... SNAP-Tag constructs were labeled with SNAP-Cell® 430 (New England BioLabs, S9109S) or SNAP-Cell® 647-SiR (New England BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: Recombinant proteins were labeled with SNAP-Surface 549 dye (New England BioLabs, Cat# S9112S) for visualization ...
-
bioRxiv - Developmental Biology 2020Quote: ... act57B sequence: 5’-UCUUCCCCUC-3’ RNA oligonucleotides were end-labeled using T4 Kinase (NEB) with ATP [γ-32P]32 ...
-
bioRxiv - Microbiology 2021Quote: ... dsRNA ladders and a 5’ Fluorescein-labeled RNA (300 nt) were provided by NEB and used as substrates for RNase I and RNase III activity assays ...