Labshake search
Citations for New England Biolabs :
101 - 150 of 461 citations for Anti P2Y12 Platelet ADP Receptor antibody produced in rabbit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and cDNA was produced using a ProtoScript® II Reverse Transcriptase (New England Biolabs) reaction and a Spike-specific reverse primer (5’ CTGAAGGAGTAGCATCCTTG 3’) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and anti-MBP antibody (NEB E8032L; 1:10,000) in 1x TBST supplemented with 5% low-fat milk were incubated either at 4 °C overnight or 1 hr at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... Receptors were surface labelled by addition of Snap-Cell 647 SiR (1:1000, New England Biolabs) to the media for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Mutations were generated in the rat P2X2 receptor using the Q5 Site-Directed Mutagenesis Kit (NEB). Each mutation was verified by DNA sequencing and subcloned in pWPT-EF1α-P2X2-GCaMP6s-IRES-DsRed2 or pWPT-EF1α-P2X2-GCaMP6s-P2A-mScarlet lentiviral vectors.
-
bioRxiv - Cell Biology 2023Quote: ... Receptors were surface labeled by addition of Snap-Cell 647 SiR (1:1000, New England Biolabs) to the media for 20 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... PCR products were produced with the Q5 High-Fidelity 2X Master Mix (New England Biolabs). All inserts were verified by sequencing ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We first produced the DNA-template for T7-transcription using PCR with Taq polymerase (NEB) and primers 11 ...
-
bioRxiv - Biochemistry 2022Quote: ... The C85S mutation was produced using a Q5 Site Directed Mutagenesis Kit (New England Biolabs) and standard cloning techniques ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the 3’ homology arm were produced by PCR (Phusion DNA polymerase, New England Biolabs). The 5’ and 3’ homology arm DNA fragments were amplified from genomic DNA prepared from vasa-Cas9 flies ...
-
bioRxiv - Plant Biology 2021Quote: ... dsRNA was produced using the HiScribe T7 High yield RNA synthesis kit (New England BioLabs). Templates were PCR products with T7 promoter sequences added to both ends to facilitate bidirectional transcription using the oligonucleotides listed in Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR products were produced with the Q5 High-Fidelity 2X Master Mix (New England Biolabs). All inserts were verified by sequencing.
-
bioRxiv - Biophysics 2021Quote: ... and 39x parS were produced by PCR using a high-fidelity polymerase (Phusion Polymerase, NEB) (see Table S1 for primer sequences) ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR products were produced with the Q5 High-Fidelity 2x Master Mix (New England Biolabs). Some fragments were ordered as gBlocks at IDT ...
-
bioRxiv - Cell Biology 2022Quote: ... The R1119G mutation in dAux was produced by performing Q5® Site-Directed Mutagenesis (NEB).
-
bioRxiv - Genetics 2021Quote: DJ-PCR products were produced with Q5® High-Fidelity DNA Polymerase (New England Biolabs) via the method of Yu et al ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplicons encompassing exon 2 of SERINC3 were produced using Taq 2x Master Mix (NEB) and the following primers ...
-
bioRxiv - Synthetic Biology 2023Quote: ... IVT mRNA was produced using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) along with 500 ng of linear template and 4 mM CleanCap AG Reagent (Trilink ...
-
bioRxiv - Molecular Biology 2023Quote: ... or uncapped U1 snRNAs were produced by in vitro transcription using T7 RNA polymerase (NEB). Briefly ...
-
bioRxiv - Biochemistry 2024Quote: RNA was produced according to our established protocols with T7 in vitro transcription kit (NEB) with labeled cy3 ...
-
bioRxiv - Cell Biology 2024Quote: Human ARHGAP18 constructs were produced using polymerase chain reaction (PCR) with New England Biolabs (NEB) Phusion High-Fidelity PCR Kit (Cat# E0553L) ...
-
bioRxiv - Immunology 2022Quote: ... As an isotype control an unspecific polyclonal rabbit antibody was used (NEB, Frankfurt, Germany). To block ORF8 during differentiation it was preincubated with the polyclonal rabbit anti-ORF8 antibody or isotype over night and added to the monocytes (t=0 ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-SNAP (1:1000, polyclonal, New England Biolabs, Ipswich, MA, P9310S), or mouse anti-tubulin (1:40,000 ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-rabbit IgG (H+L) (DyLight™ 800 4X PEG Conjugate, NEB) or anti-mouse IgG (H+L ...
-
bioRxiv - Microbiology 2024Quote: ... MBP fusion proteins were detected with a rabbit anti-MBP from NEB company 1:1000 followed by an incubation with a goat anti-rabbit HRP-conjugated (1:3000) ...
-
bioRxiv - Microbiology 2024Quote: ... and detected using anti-MBP antibodies (New England Biolabs). As a negative control ...
-
bioRxiv - Molecular Biology 2022Quote: Anti-M13-pIII monoclonal antibody (E8033S, New England Biolabs), sheep anti-mouse IgG (H/L):HRP (AAC10P ...
-
bioRxiv - Plant Biology 2023Quote: ... after which an anti-p42/p44-erk antibody (NEB) was employed to detect the activated MAPKs on western blots.
-
bioRxiv - Cell Biology 2023Quote: ... anti-SNAP-tag antibody (New England Biolabs, Ref. P9310S), anti-clathrin heavy chain antibody (BD Bioscience ...
-
bioRxiv - Cell Biology 2023Quote: ... Receptors were surface labeled by addition of SNAP-Surface Alexa Fluor 546 (1:1000, New England Biolabs) to DMEM F12 without serum and phenol red (21041-025 ...
-
bioRxiv - Developmental Biology 2020Quote: Double-stranded RNA (dsRNA) was produced by simultaneous transcription with T7 RNA polymerase (New England Biolabs) on PCR products containing T7 promoter sequences (CGACTCACTATAGGG ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 200 μL of PCR product was produced using Phusion Hotstart Flex polymerase (New England Biolabs, M0535S). The entirety of this PCR product was run on a gel ...
-
bioRxiv - Biophysics 2020Quote: ... A 478 bp fragment of biotin labelled DNA was produced by PCR with Taq Polymerase (NEB) of λ-DNA using the following primers ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... transcriptomic libraries were produced using NEBNext® Ultra RNA Library Prep Kit for Illumina® (NEB) with mRNA isolation performed with poly-A mRNA beads ...
-
bioRxiv - Biochemistry 2022Quote: ... CBP (Chitin Binding Protein, produced by N. Martín in Dr. Casanova’s lab, New England Biolabs Protocol) was used as a secondary antibody at 1:300 to detect chitin and visualize the tracheal branches ...
-
bioRxiv - Synthetic Biology 2024Quote: ... IVT-produced RNA samples were purified using a Monarch® RNA Cleanup Kit (New England Biolabs). ssRNA during RNA extractions was degraded with RNase T1 (Thermo Scientific) ...
-
bioRxiv - Immunology 2023Quote: The mRNAs used in this study were produced using HiScribe T7 mRNA synthesis kit (NEB, Australia) using linearized DNA produced by PCR amplification ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were produced with a NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs) and sequenced on an Illumina NovaSeq 6000 platform using a 2 × 150 bp run protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Amplification of target sequences under 5 kb were produced using Q5 high fidelity polymerase (NEB # M0491S) under the recommended three-step amplification conditions ...
-
bioRxiv - Biochemistry 2024Quote: ... Isolated truncations were produced by deletion PCR using Q5 site-directed mutagenesis kit (New England Biolabs) and contained an N-terminal His-SUMO tag ...
-
bioRxiv - Biophysics 2024Quote: Raw plasmid DNA was treated with Cre recombinase (produced in the lab) and then ScaI (NEB), to liberate excised minicircles ...
-
bioRxiv - Biochemistry 2023Quote: ... Using 10 μg of custom-made rabbit polyclonal anti-AcK142 Ab (Ez Biolabs), AcK142 PNKP was IP’d from 1 mg of GO-treated chromatin fraction from WT-PNKP-FLAG and K142R-PNKP-FLAG expressing cells ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmids encoding chimeric SCS6/MLA1 and SCS6/MLA6 receptors were assembled using the NEBuilder HiFi assembly Kit (NEB) based on the domain boundaries reported in (28) ...
-
bioRxiv - Microbiology 2021Quote: ... or 5 µl anti-H3K18cr antibody (PTM-517, PTM Biolabs) together with protein A agarose (Roche ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl anti-MBP Monoclonal Antibody (New England Biolabs, #E8032L) and 6 μl anti-E ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-MBP antibody from mice (New England Biolabs, 1:3000), Goat anti-mouse IgG HRP conjugated (Thermo Fisher ...
-
bioRxiv - Physiology 2020Quote: ... Membranes were washed with TBS-T and then incubated with an anti-rabbit horseradish peroxidase conjugated secondary antibody (New England Biolabs, 1:10,000 in 5% skim milk in TBS-T) for 2h ...
-
bioRxiv - Molecular Biology 2021Quote: sgRNAs were produced by in vitro transcription using the HiScribe T7 High Yield RNA synthesis kit (NEB) with PCR amplified gBlocks (IDT ...
-
bioRxiv - Biochemistry 2021Quote: ... R77E/A variants were produced by site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, New England Biolabs), verified by sequencing ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA substrates were produced by run-off in vitro transcription using T7 RNA polymerase (New England Biolabs) and purified via anion exchange chromatography as described before with slight modifications 36,67 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Specific DIG-labelled RNA probes were produced using HiScribe Sp6 and T7 in vitro transcription kits (NEB). The sequences of the probes are in the Supplementary Table 5 ...