Labshake search
Citations for New England Biolabs :
451 - 461 of 461 citations for Anti P2Y12 Platelet ADP Receptor antibody produced in rabbit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... the reaction was started in the absence of GTP and in the presence of 0.5 mM of anti-reverse m7G-cap analog (NEB #S1411) for 10 min ...
-
bioRxiv - Biochemistry 2023Quote: ... sgRNA-hKCTD5 sense CACCGCGAGCTCCTGTCGCCGGCC and sgRNA-hKCTD5 anti-sense AAACGGCCGGCGACAGGAGCTCGC followed by phosphorylation of the double-stranded DNA by T4 kinase (NEB). The sgRNA was cloned into pX330 (a generous gift from S ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 15 µl of anti-MBP couped beads (pre-blocked for 1h in RIPA with 3 % BSA; NEB) for 2 h ...
-
bioRxiv - Immunology 2020Quote: CAR-encoding mRNA was transcribed from linearized plasmids encoding anti-human CD19 CAR61 and anti-mouse CD19 CAR71 using T7 RNA polymerase (HiScribe™ T7 High Yield RNA Synthesis Kit, New England Biolabs). The mRNAs were transcribed to contain the 5′ UTR derived from the human a-globin 5′ leader RNA ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was synthesized as described (Schäfer et al., 2018) in the presence of anti-reverse cap analog (NEB or Jena Biosciences) and gel-purified ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transcribed into mRNA which was co-transcriptionally capped with the Anti-Reverse Cap Analog (ARCA) 3′-O-Me-m7G(5′)ppp(5′)G (NEB # S1411) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were washed three times with a PBS buffer 1X and then incubated with mouse anti-MBP (NEB, Cat# E8032L) or rabbit anti-V5 (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2021Quote: ... The RNAs were co-transcriptionally capped with m7G anti-reverse cap analog or ApppG Cap Analog (New England Biolabs, 1411 and Cat#1406). The RNAs were purified using a Purelink RNA Mini Kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... with rotation for 1 hour at room temperature followed by further incubation for 1 hour with the addition of 15 μl of goat anti-mouse IgG magnetic beads (New England Biolabs, Ipswich, MA, USA). The magnetic beads in the supernatant were collected on a magnetic stand and washed 2 times with PBS ...