Labshake search
Citations for New England Biolabs :
101 - 150 of 1891 citations for Anion Exchange Membranes Thickness 10 13 µm since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: The extracted RNAs from the BCoV-13 were treated with DNase I (RNase-free) (New England BioLabs; Lot. # 10213692) following manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Cat. No. B6002S]; 2.5 µl 100 µM gRNA [ordered as a synthesized oligo]; 2 µl 100 µM LbaCas12a [NEB, Cat. No. M0653T]) was incubated for 5 minutes at room temperature.
-
bioRxiv - Neuroscience 2021Quote: ... and PCR amplified for 13 cycles with Illumina Nextera adapter primers using the NEBNext High Fidelity 2X Master Mix (NEB) with the following PCR program ...
-
bioRxiv - Molecular Biology 2022Quote: ... regions flanking each target site were PCR amplified using locus-specific primers bearing tails complementary to the TruSeq Illumina adapters as described previously.13 25-50ng input genomic DNA is PCR amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs): (98°C ...
-
bioRxiv - Immunology 2022Quote: ... In vitro transcription (IVT) was performed at 37°C for 13-16h with the HiScribe T7 RNA Polymerase kit (NEB). The remaining DNA was digested by Turbo DNase I (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... Then barcodes from the Native Barcoding Expansion 1-12 & 13-24 from Oxford Nanopore Technologies (ONT) were ligated using the NEBNext Ultra II Ligation Module (NEB). DNA was purified using Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pre-amplified PCR products were transferred to 96-well plates and further amplified for an additional 13 cycles using custom Nextera dual-index primers and NEBNext High-Fidelity 2X PCR master mix (New England Biolabs). Individually barcoded libraries were pooled and purified on a single MinElute column (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... Barcodes from the Native Barcoding Expansion 1-12 & 13-24 from ONT were ligated using the NEBNext Ultra II Ligation Module (NEB). DNA was purified using Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2023Quote: ... and JSW-SS-34:41 (AATGATACGGCGACCACCGAGATCTACAC NNNNNNNN TCGTCGGCAGCGTC) to amplify libraries for 11-13 cycles using Phusion High Fidelity PCR Master Mix (NEB) instead of the Illumina-supplied PCR reagents ...
-
bioRxiv - Microbiology 2023Quote: ... barcodes from the Native Barcoding Expansion 1-12 & 13-24 from Oxford Nanopore Technologies (ONT) were ligated using the NEBNext Ultra II Ligation Module (NEB). DNA purifications were made using Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Immunology 2022Quote: ... Then 13 μl PCR heteroduplexes were digested by 2 μl of 1 U/μL T7 Endonuclease I (New England Biolabs) at 37°C for 60 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... SNAP Cell-SIR647 (New England BioLabs, S9102S, 0.3 µM); PEG 1500 (Roche ...
-
bioRxiv - Biophysics 2022Quote: ... and 0.12 µM SiR-SNAP-Tag ligand (NEB, S9102S) for 30 min at 37°C and 5% CO2 ...
-
bioRxiv - Microbiology 2020Quote: ... 1 µM SNAP-Cell TMR Star (New England Biolabs) was added to label the SNAP tag ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.3 µM fluorescent SNAP substrate (TMR Star, NEB, S9105) was added along with the primary antibodies
-
bioRxiv - Molecular Biology 2022Quote: ... and 8 µM BC-647 (CLIP-Surface 647, NEB) in a base solution of Passive Lysis Buffer was rotated overnight at 4°C to label CLIP-tagged proteins ...
-
bioRxiv - Cell Biology 2024Quote: ... and complexed with Cas9 (1.5 µL 1 µM, NEB). CRISPR/Cas9 complexes and 100 pmol annealed repair template were electroporated (Neon transfection system ...
-
bioRxiv - Biophysics 2024Quote: ... 650 µM of BG-NH2 (New England Biolabs, S9148) was added to the mixture ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 µM Mth RNA Ligase (New England Biolabs). The 100 µl master mix was split into 4 aliquots (25 µl each ...
-
bioRxiv - Genomics 2024Quote: ... 1 µM NEBNext Universal PCR Primer for Illumina (NEB) was added to each reaction followed by amplification at 98°C for 45 sec ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... was prepared by combining 2 µL of 100 µM guide RNA (gRNA) with 2 µL of 20 µM EnGen SpyCas9 NLS (NEB, Cat. No. M0646T), and incubated at room temperature for 2-4 hours ...
-
bioRxiv - Biochemistry 2024Quote: ... 13 nt long RNA was radiolabelled at the 5’-end with [γ-32P] ATP and T4 Polynucleotide kinase (New England Biolabs) prior to complexes assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... A 13 nt RNA oligonucleotide was radiolabeled at the 5’ end with [γ-32P] ATP and T4 polynucleotide kinase (New England Biolabs) prior to EC assembly ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were pulse-labeled with SNAPcell-505 (1 µM; NEB) for 20 min in media ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µl of 20 µM SpCas9 (NEB, Cat. No. M0646M) was placed in the bottom of a 0.25 ml PCR tube ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 µM of SNAP-Surface Alexa Fluor 647 (NEB) in extracellular buffer for 30 minutes at 37 °C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1 µM overexpressed T7 RNA polymerase (conversely New England Biolabs T7 RNA Polymerase M0251L can be used ...
-
bioRxiv - Molecular Biology 2024Quote: ... 40 µM FeSO4 and 1 µl murine RNase inhibitor (NEB). The products of the reactions were digested to nucleosides and analyzed by LC-MS/MS ...
-
bioRxiv - Microbiology 2024Quote: ... 50 µM ATP and 1 x RNA ligation buffer (NEB) at 25 °C for 16 h ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2 µL of 20 µM SpCas9 (New England Biolabs M0646T) were gently mixed with 2 µL of 100 µM gRNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated with 1 µM TMR (tetramethylrhodamine) star (NEB) for 30 min at 37°C for the pulse step ...
-
bioRxiv - Bioengineering 2024Quote: ... 0.2 µL (100 µM) deoxynucleotides (dNTP) (N0447L, New England Biolabs), 0.1 µL (20 µM ...
-
bioRxiv - Developmental Biology 2024Quote: ... together with 2 µM of Cas9 protein (NEB, Cat# M0646T). Tol2-plasmids were diluted in 0.05% Phenol red to a final concentration of 100 ng/µL ...
-
bioRxiv - Microbiology 2021Quote: ... PCRs were performed in 25 μL reaction volumes and contained 13 μL Q5® Hot Start High-Fidelity 2× Master Mix (New England Biolabs, US), 0.5 μM of each primer and 0.4 μL of 25 mg/mL BSA ...
-
bioRxiv - Microbiology 2023Quote: ... 10 ng of library DNA was amplified with the p7 primer and the IS-Seq Step1 primer (Table S5) for 13 cycles using Q5 2X Master Mix (New England Biolabs, Ipswich, MA). These reaction products were diluted 1:100 and 10 µL was added to a PCR reaction with the p7 primer and the IS-Seq Step2 primer for 9 cycles using Q5 2X Master Mix ...
-
bioRxiv - Genomics 2024Quote: ... and amplified using ISOSDB412 IS-Seq Step1 and p7 primers for 13 cycles using Q5 Master Mix (New England Biolabs, Ipswich, MA). The products of this reaction were amplified with IS-Seq Step2 and p7 primers for 9 cycles using Q5 Master Mix and sequenced on a Novaseq 6000 at Novogene (Sacramento ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 μL GlycoBuffer 2 (10 ×) (NEB), 10 μL 10% NP-40 (NEB) ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 μL 10% NP-40 (NEB), 10 μL PNGase F (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 µL MnCl2 (10 mM NEB), 10 µL phosphatase buffer (10x PMP buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were transferred to nitrocellulose membranes (Biolabs, 1620115). Membranes were then incubated with primary antibody diluted in 5% milk or 2.5% BSA in Triton X-100-TBS buffer (T-TBS ...
-
bioRxiv - Physiology 2022Quote: ... Histones H3-H4 (0.33 µM, catalog no. M2509S, New England Biolabs) and H2A-H2B (0.33 µM ...
-
bioRxiv - Physiology 2022Quote: ... and H2A-H2B (0.33 µM, catalog no. M2508S, New England Biolabs) were incubated with increasing concentrations of MBP-mGCNA (0.165 ...
-
bioRxiv - Microbiology 2022Quote: ... 187.5 µM RNA cap analogue (GpppA or GpppG, New England Biolabs) or 18.75 µM Cap 0 RNA oligo (TriLink ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 µL of 20 µM H2A/H2B dimer (New England BioLabs), and 50 µL of 10 µM H3/H4 tetramer (New England BioLabs) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5 mM DTT with 1.5 µM recombinant H3 (New England Biolabs), vehicle or 500 nM recombinant enzyme ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM HDVLig (pre-adenylated using a 5’ adenylation kit (NEB)) ...
-
bioRxiv - Genomics 2023Quote: ... 1.56 µL of 500 µM β-Nicotinamide adenine dinucleotide (NAD+) (NEB), and 15U of E ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 µM dNTPs and 2.5 U Q5 Hot-Start polymerase (NEB). A touchdown protocol was used to increase the specificity of the PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM DTT and 400 µM vanadyl ribonucleoside complexes (VRC; NEB)] supplemented with RNasin and Halt Protease Inhibitor Cocktail on ice for 10 min ...
-
bioRxiv - Genetics 2024Quote: ... 1.5 µl of 25 µM dNTPs (New England BioLabs, Cat# N0446S), 1 µl molecular grade H2O ...