Labshake search
Citations for New England Biolabs :
1 - 50 of 1891 citations for Anion Exchange Membranes Thickness 10 13 µm since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 13 μl of 10× NEBuffer3.1 and 100 units of MboI (NEB, R0147M) were added and the chromatin was digested at 37 °C overnight while shaking ...
-
bioRxiv - Microbiology 2024Quote: ... 10 µM of dNTPs (New England Biolabs) and 10 µM of primer XhoI-T7-5’ [AGCTCTCGAGACCATGAACACCATCAATATTGCC] and EcoRI-§-T7-3’ [GCATGAATTCTCAGGCAAATGCGAAATCGGA] ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 10 µM RP1 primer (NEB), 1 µL ddH2O and PCR amplified for 16-18 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 10 µM RPI primer (NEB), 2 µL 10 µM RP1 primer (NEB) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µl Forward Stagger Mix (10 µM) and 2 µl Reverse Index Primer (10 µM) specific to each vector backbone and Nuclease-free water (NEB,USA) up to 50 µl ...
-
bioRxiv - Developmental Biology 2024Quote: A Primer Exchange Reaction concatemerization reaction (1X PBS; 10 mM MgSO4; dNTP, 0.6 mM of A, C, and T, NEB-N0446S ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were initially incubated with SNAPcell block (10 µM; NEB) diluted in culture media for 20 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... in 1x T4 DNA ligase buffer with 10 µM ATP (NEB) in 10 µL reactions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3.5 µL ddH2O and 1 µL 10 µM RTP primer (NEB) was added ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a PCR with 10-13 cycles was performed using the NEBNext High Fidelity 2X PCR Master Mix (NEB) and Ad1_noMX and Ad2.1–2.12 barcoded primers described in (30) ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 µM Verapamil in DMSO (Spirochrome) and of 0.6 µM SNAP-Cell TMR-Star in DMSO (New England Biolabs (S9105S) for 120 mins as per manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µM purified SNAP-tagged proteins were reacted with 10 µM biotin-conjugated benzylguanine (BG-bio) (S9110S; New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... an identical labeling scheme was followed using CLIPcell block (10 µM; NEB) and CLIPcell-TMR (1 µM ...
-
bioRxiv - Biochemistry 2020Quote: ... and 50 µL of 10 µM H3/H4 tetramer (New England BioLabs). The NaCl concentration was gradually lowered by adding increasing volumes of 10 mM Tris HCl (pH 8 ...
-
bioRxiv - Genetics 2021Quote: ... 10 µM dNTP and 0.05 U Taq DNA polymerase (New England Biolabs). An initial denaturation step at 97°C for 2 minutes was followed by 45 cycles of 10 seconds at 95°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and SNAP-Surface Block at 13 μM (NEB) for 20 min at 25°C (for intracellular labeling ...
-
bioRxiv - Genomics 2024Quote: ... and 13% second strand synthesis enzyme mix (NEB) was added ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µl Reverse External Primer (10 µM) and Nuclease-free water (NEB,USA) up to 100 µl were mixed on ice ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2.5 µl NEBNext Multiplex Oligos for Illumina (10 µM) (#E6609, New England Biolabs), 10 µl adaptor-ligated DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 µM of primers were combined with OneTaq QuickLoad Master Mix (NEB #M0486) and run in a thermocycler as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 µM of each primer was combined with OneTaq QuickLoad Master Mix (NEB #M0486) and run in a thermocycler as follows ...
-
bioRxiv - Systems Biology 2020Quote: ... 10 mM DTT, 12% PEG 8000, 1 mM each dNTPs, 10 µM dN-SMRT oligo, 5 µl Klenow enzyme NEB #M0212) for 1 h at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and produced by PCR amplification (10–13 cycles) of tagmented DNA using a NEB Next High-Fidelity 2× PCR Master Mix (New England Biolabs, Ipswich, MA, USA). DNA fragments were then purified using the MinElute PCR Purification Kit and eluted in 10 µL elution buffer ...
-
bioRxiv - Genomics 2024Quote: ... 0.8 µL 8-HQ (500 µM) and 0.2 µL Therminator IX (NEB 10 U/µL) for 10-min incubation at 60°C.
-
bioRxiv - Cell Biology 2024Quote: ... 20 mL ERA reaction (13 T4 DNA ligase buffer [NEB] ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Cas12a RNP: (13 µl water; 2 µl r2.1 buffer [NEB, Cat ...
-
bioRxiv - Microbiology 2023Quote: ... the allelic exchange vector pMQ30 was first digested with SmaI (New England BioLabs) and ∼1.5kb flanking regions of the targeted gene were amplified using Phusion polymerase (New England BioLabs ...
-
bioRxiv - Genomics 2024Quote: ... 1.8 µL of 8-HQ (500 µM) and 0.2 µL Therminator IX (NEB, 10 U/µL) were added ...
-
bioRxiv - Microbiology 2024Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Cell Biology 2024Quote: ... existing CENP-A-SNAP proteins were labelled for 30 min using 10 µM SNAP-Cell Block (NEB) and cells were exposed to media containing 5 µM S-trityl-L-cysteine (STLC - Sigma-Aldrich ...
-
bioRxiv - Genomics 2023Quote: ... Then we added 13 μl of Q5 Ultra II (NEB, 2x mastermix), 1 μl S5 primer ...
-
bioRxiv - Genetics 2024Quote: ... 0.5 µl of each primer (10 µM) and 12.5 µl Luna Universal Probe qPCR Master Mix (NEB, M3004) were mixed in a final volume of 25 µl ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified for 13 cycles using Q5 High-Fidelity 2X Master Mix (NEB) according to manufacturer's instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... we added 1μL unique barcoded N5&N7 (0.5 µM final concentration) and 10 μL NEBNext High-Fidelity 2x PCR Master Mix (NEB). PCR cycling conditions were as follow ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL Pr_P7 (10 µM; Supplementary Table 1) and 0.5 µL Vent (exo-) DNA Polymerase (NEB 2 U/µL). The PCR program comprised an initial denaturation step (95°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 250 µM CoCl2 (NEB), 100 µM dATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 µM dNTPs (NEB), 0.5 µM forward primer ...
-
bioRxiv - Genomics 2024Quote: ... 500 µM dNTPs (NEB), 67 U/mL of USER enzyme (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... first with 20 pmol membrane impermeable SNAP dye (10 μM SNAP-Surface® 488, New England BioLabs Inc.) followed by 20 pmol membrane permeable SNAP dye (10 μM SNAP-Cell® 647-SiR ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were grown on glass coverslips and pre-existing SNAP-tagged histones were first quenched by incubating cells with 10 µM of the non-fluorescent substrate SNAP-cell Block (New England Biolabs) for 30 min followed by a 30 min-wash in fresh medium and a 2 hr-chase ...
-
bioRxiv - Genomics 2021Quote: ... The PCR mix (8 µl H2O, 2 µl primer mix P5Solexa/P3Solexa, 10 µM each, 20 µl Phusion HF Mix [New England Biolabs]) was added to 10 µl cDNA ...
-
bioRxiv - Microbiology 2022Quote: ... and an equimolar mix of primers P5-IR2a-d primer (10 µM) in a reaction with 50 ng of adaptor ligated template and Phusion DNA polymerase (NEB) in a thermocycler with the following program 98°C 3 min ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl of 5’ adapter (10 µM) was added and incubated for 5 min at 65°C before addition of T4 ligase buffer (NEB), final 25% PEG8000 and T4 RNA ligase 1 (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: Each pair of top and bottom oligonucleotides were phosphorylated and annealed by incubating 10 µM of each with 1 × T4 DNA ligase buffer (New England Biolabs), 5U T4 polynucleotide kinase (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext® High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl of the 1:10 diluted adapter-ligated library aliquot were amplified in 10-µl reactions containing 1 µM NEBNext Universal PCR Primer for Illumina (NEB), 1 µM NEB_mws20 primer (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T (IDT) ...
-
bioRxiv - Cell Biology 2024Quote: ... Apoptotic cells were generated by supplementing cell culture with 10 µM staurosporine (Cayman) to induce apoptosis74 and 1 unit/mL DNAse I (New England Biolabs) to prevent cells from clumping ...
-
MET functions in tumour progression and therapy resistance are repressed by intronic polyadenylationbioRxiv - Molecular Biology 2023Quote: ... Libraries were amplified by 13 cycles of PCR with Phusion polymerase (New England Biolabs). A size selection step was done using Agencourt AMPure XP (Beckman Coulter ...