Labshake search
Citations for New England Biolabs :
101 - 150 of 2865 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... was designed with 4 nt 5’ overhangs that match 5’ overhangs of the pCsm vector left by linearization with BbsI (NEB). 10 pmoles of each oligonucleotide set were annealed in 1X CutSmart buffer (NEB ...
-
Dissecting β-Cardiac Myosin and Cardiac Myosin-Binding Protein C Interactions using a Nanosurf AssaybioRxiv - Biophysics 2022Quote: ... benzyl-guanine NHS ester (BG-GLA-NHS; New England Biolabs, Ipswich, MA) was covalently linked to C6-amine oligonucleotides (with or without Cy3 modification ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were centrifuged for 5 minutes at 5000rpm at 4°C and supernatant treated with 5 mg/ml of proteinase K (New England Biolabs #P8102) for 1 hour at 50°C ...
-
bioRxiv - Cancer Biology 2020Quote: RNA 5’-ends were phosphorylated using 4 µl T4 PNK (NEB, catalog no. M0201) in a solution consisting of 8 µl 10x PNK buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... activation was performed overnight at 4 °C with 5 μg of Factor Xa (NEB) per mg of protein ...
-
bioRxiv - Microbiology 2021Quote: ... 4°C and the supernatant applied on a 6 ml gravity flow column with Chitin resin (New England Biolabs), equilibrated with 20 mM HEPES ...
-
bioRxiv - Microbiology 2020Quote: ... was linearized in a 500 μL reaction volume containing 100 units of ApaLI enzyme for 4-6 hours at 37°C in CutSmart buffer (New England Biolabs). The DNA was then ethanol precipitated as previously described (76) ...
-
bioRxiv - Molecular Biology 2022Quote: The HRAS minigene reporter was constructed by PCR amplifying a ∼900bp region spanning exon 4 to exon 6 from human genomic DNA isolated from HEK293 cells using Phusion high- fidelity DNA polymerase (NEB). The PCR fragment were inserted into pcDNA3.1(+ ...
-
bioRxiv - Cell Biology 2021Quote: ... N-hydroxysuccinimide ester (BG-GLA-NHS) functionalized benzylguanine was purchased from NEB (Cat #S9151S) and freshly reconstituted in DMSO to a final concentration of 83 mM ...
-
bioRxiv - Biochemistry 2020Quote: ... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
bioRxiv - Neuroscience 2022Quote: ... The 5’ and 3’ arms (5 to 8 kb) were amplified from a C57Bl/6 BAC clone by PCR using Q5 polymerase (New England Biolabs) and inserted into a cloning vector that contains frt-flanked SV-Neo for positive selection and Pgk-DTA and HSV-TK genes for negative selection (Jarvie et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was initiated by adding 4 μl of 5× ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Biophysics 2020Quote: ... the 5’ end of the 4 kb transcript was biotin-labeled using Vaccinia Capping System (NEB) and 3-biotin-GTP (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos were 5’-end radiolabeled at a final concentration of 4 μM with T4 PNK (NEB) and γ-32P-ATP after incubation for one hour at 37°C followed by enzyme inactivation at 72°C for 10 minutes ...
-
bioRxiv - Genetics 2024Quote: ... 4) IDS-KO receiving 1 mg/kg idursulfase IV and nebulized idursulfase (KO-NEB, n = 5). The nebulized idursulfase was delivered as 167 µL of 2 mg/mL ...
-
bioRxiv - Immunology 2021Quote: ... were generated by introducing the corresponding amino acid mutations (Extended Data Fig. 5) using the Q5® Site-Directed Mutagenesis Kit (NEB) and per manufacturer’s protocol.
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ phosphorylation was performed by mixing 6 uL of rRNA depleted RNA with 1 uL of 10X PNK buffer (NEB B0201S), 1 uL of PNK enzyme (NEB M0236S) ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
Differential impact of a dyskeratosis congenita mutation in TPP1 on mouse hematopoiesis and germlinebioRxiv - Cell Biology 2021Quote: ... 5′ 32P-labeled (TTAGGG)4 oligonucleotide (labeled using [γ-32P]ATP and T4 PNK; New England Biolabs) was added ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nuclei were centrifuged (500xg, 5 min, 4°C) and washed once with 1X NEBuffer 2.1 (NEB, #B7202). For nucleosome depletion ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Nuclei were pelleted at 500 ξ g at 4°C for 5 minutes and resuspended in 0.5 mL of 1.2x NEBuffer r2.1 (New England Biolabs) containing 3% sodium dodecyl sulfate (SDS ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid (5 μL) was used as template for reverse transcription using LunaScript® RT SuperMix Kit (New England Biolabs, Hitchin, UK) in 20 μL reaction volume ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Microbiology 2021Quote: ... purple (6×) (New England Biolabs). Samples were loaded into a 4-15% precast polyacrylamide gel ...
-
bioRxiv - Molecular Biology 2020Quote: ... Random Primer 6 (NEB, #S1230S), RNasin Ribonuclease inhibitor (Promega ...
-
bioRxiv - Microbiology 2024Quote: ... 6 U DNase-I (NEB) and 3 µL RNase A (NEB ...
-
bioRxiv - Genomics 2024Quote: ... and random primer 6 (NEB). The NEBNext Ultra II Non Directional RNA Second Strand Synthesis Module was subsequently used to convert single-stranded cDNA to double-stranded cDNA ...
-
bioRxiv - Biochemistry 2023Quote: ... formic acid was purchased from Biolabs ltd ...
-
bioRxiv - Systems Biology 2020Quote: ... we first phosphorylated the 5’ ends of each probe set by combining 4 μL of the pooled oligos with 1 μL T4 PNK (NEB), 20 μL T7 DNA ligase reaction buffer (NEB) ...
-
bioRxiv - Bioengineering 2022Quote: ... the two primers which contain the gRNA and have 4 nt overhang at 5’-end were annealed (3) the annealing product was ligated with PaqC I (New England Biolabs)-digested pMM002P or pMM005 ...
-
bioRxiv - Biochemistry 2023Quote: ... The duplex hRNase 4 cleavage products (5′ fragments of the RNA) were enriched using Hydrophilic Streptavidin Magnetic Beads (New England Biolabs). The beads were washed twice by a high salt buffer (5 mM Tris HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... slides were rinsed three times with deionized water for 5 minutes and incubated in 1x Terminal Transferase (TdT) buffer containing 1X buffer 4 (NEB) and 2.5 μM CoCL2 for 10 minutes at room temperature in a humid chamber ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 μl of 10 mM MnCl and 6 μl (=2400 units) of Lambda phosphatase (#P0753, NEB). Dephosphorylation was carried out at 30°C for 30 minutes and stopped by addition of Roti Load buffer (#K929.1 ...
-
bioRxiv - Genomics 2024Quote: ... and Random Primer 6 (NEB, S1230S). The samples were finally purified using AMPure XP Beads (Beckman Coulter Life Sciences ...
-
bioRxiv - Biochemistry 2024Quote: ... A His-Tag encoding sequence was added to the C-terminus of RnfG by using oligonucleotides 5 and 6 via site-directed mutagenesis (Q5® Site-Directed Mutagenesis Kit, NEB, Frankfurt am Main, Germany). The resulting plasmid was checked by sequencing analysis (Microsynth Seqlab ...
-
bioRxiv - Biophysics 2024Quote: ... Nucleic acid was treated with DNase (NEB), purified using RNA SPRI beads ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Genetics 2021Quote: ... Nuclei were pelleted at 500 rcf at 4°C for 5 minutes and resuspended in 90 uL 1X Cutsmart Buffer (NEB B7204S). 10 uL of 10U/uL AluI restriction enzyme (NEB R0137S ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Plant Biology 2024Quote: RNA was isolated from leaves 4 and 5 using Trizol and cDNA was synthesized using MuMLV reverse transcriptase (New England Biolabs, Inc.) primed with random hexamers ...
-
bioRxiv - Bioengineering 2024Quote: ... The plasmid pool was then digested with the outer guides M1 and P1 (5 μg plasmid pool, 10 μL M1+P1 Cas9 RNP, 4 μL 10X rCutSmart buffer (NEB, B6004S), and H2O to 40 μL incubated at 37°C for 1 hour) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digests with 6 x loading dye (NEB) were run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... with 6 μl CutSmart Buffer (NEB, B7204) in a total volume of 60 μl for 3 hours at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... and 6 U Bst3.0 DNA polymerase (NEB) in total 15 μl reaction volume ...
-
bioRxiv - Microbiology 2020Quote: ... 6 mM MgSO4 (NEB, final 8mM Mg2+), 1.4 mM each dNTP (Enzynomics) ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... 6 mM MgSO4 (100 mM stock, NEB), 0.32 U/μl NEB Bst 2.0 polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digest with 6 x loading dye (NEB) was run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 6 U of Heparinase I (NEB) was added to the first strand cDNA synthesis mix ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 μl BST LF polymerase (NEB M0275L), and 36 μl DEPC-treated H2O ...