Labshake search
Citations for New England Biolabs :
101 - 150 of 4119 citations for 5 Bromo 2 3 dihydro 1H indole hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.15 U Klenow Fragment (3’→5’ exo-) (NEB) in 1X NEBuffer 2 at 37°C for 30 minutes (cite) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5μL Klenow Fragment (3′->5′ exo-, NEB, N0202S) for A-tailing were added at 37°C for 40 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... A-tailed with Klenow 3’ to 5’ exo-(NEB), ligated to Illumina Truseq LT adaptors using Quick Ligase enzyme (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 3 μL 5× Phusion HF buffer (New England Biolabs), 2.7 μL dH2O ...
-
bioRxiv - Genomics 2022Quote: ... A-tailed with Klenow 3’ to 5’ exo-(NEB), ligated to Illumina Truseq LT adaptors using Quick Ligase enzyme (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 μL 5× Phusion HF buffer (New England Biolabs), 2.7 μL dH2O ...
-
bioRxiv - Cancer Biology 2023Quote: ... NU-1611-Cy3),1.5ul of Klenow Fragment (3’→5′ exo-, NEB, M0212S) and 1.5ul of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.5ul of Klenow Fragment (3’→5′ exo-, NEB, M0212S) and 1.5ul of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2020Quote: ... A-tailing 3’ end was performed using Klenow Fragment (3’→5’ exo-) (New England Biolabs), and then TruSeq Adapters were ligated by Quick T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by addition of 3’-A overhangs using Klenow Fragment 3’-5’ exo- (NEB, M0212S). After denaturation of DNA at 95°C for 3 min ...
-
bioRxiv - Cell Biology 2021Quote: ... A-tailing 3’ end was performed using Klenow Fragment (3’→5’ exo-) (New England Biolabs), and then TruSeq Adapters were ligated by Quick T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Neuroscience 2020Quote: ... with TdTomato was amplified by PCR with primers (5’- ggcgcgCCCCCCTCTCCCTCCCCCCC -3’ and 5’- ggcgcgccTTACTTGTACAGCTCGTCCATGCCGTACAG -3’) using Hot start Q5® polymerase (NEB, Frankfurt, Germany) from LeGO-iT (a gift from Boris Fehse ...
-
bioRxiv - Cell Biology 2024Quote: ... containing a 5′-Biotin-PC group and a 3’-OH (Sup. Table. 2) were ligated to the 5′ end of RNAs using T4 RNA ligase (NEB, Cat #M0204S) for 3 hours at 37°C ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3’ end filling and dA tailing was performed by Klenow Fragment (3’>5’ exonuclease deficient; NEB). Libraries were prepared by ligation of NEBNext adapters and indexed i7 primers (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Genomics 2021Quote: ... Adenylation was performed with 3’-5’ Klenow Fragment (NEB M0212L). Adaptors were ligated with NEB Quick Ligase for 10 minutes at 30°C before two rounds of cleanup with homemade beads ...
-
bioRxiv - Plant Biology 2021Quote: ... using a Klenow fragment (3′ → 5′ exo−) (New England Biolabs). Hybridization was performed at 65°C overnight in the pre-hybridization solution containing 6x saline-sodium citrate buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 15 units of Klenow Fragment (3’→5’ exo-, NEB). Following extension reactions ...
-
bioRxiv - Biochemistry 2022Quote: ... A-tailing (Klenow fragment (3’-5’ exo–, New England Biolabs), ligation to barcoded adapters (KAPA) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’-CTTTTGACATCCGCTTCTGC-3’ followed by a T7 endonuclease assay (NEB) to detect indels ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by A-tailing (Klenow 3’-> 5’ exo-, NEB, M0212S). After A-tailing ...
-
bioRxiv - Genomics 2023Quote: ... and 7.5 U of Klenow fragment 3’→5’ exo-(NEB), except for input DNA that is degraded (e.g. ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 μL of Klenow Fragment (3’ -> 5’ exo -, NEB M0212L), 5 μL 50% PEG 8000 ...
-
bioRxiv - Cell Biology 2023Quote: ... using Large Klenow fragment 3’-5’ exo- (New England Biolabs). Biotinylated 19x 601 array DNA ...
-
bioRxiv - Genomics 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (New England Biolabs) for 30 min at 37 °C and purified by using a QIAquick PCR Purification Kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼500 bp 5’ and 3’ flanking regions of Tb427.10.12290 (NEB) with primers SMD400/1 and SMD404/5 respectively using (Lister strain 427 ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ triphosphorylated RNA was capped with 3’-desthiobiotin-TEG-guanosine 5’ triphosphate (DTBGTP) (New England Biolabs) using the vaccinia capping enzyme (VCE ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL 10X NEB Buffer #2 (NEB #B7002S), 5 µL RppH (NEB #M0356S) ...
-
bioRxiv - Microbiology 2023Quote: ... or deglycosylated by an 1h treatment with PNGase F (NEB) then eluted in 2X Laemmli as previously described.
-
bioRxiv - Molecular Biology 2022Quote: ... 2-3 ×106 cells were treated with MNase (NEB M0247) ranging from 10-30 Kunitz U in 800 μl of custom buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’-triphosporylated RNA was capped with 3’-desthiobiotin-TEG-GTP (NEB)) using the Vaccinia virus Capping enzyme (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... then free 3 adaptors were degraded using 5 deadenylase (NEB, M0331) and RecJf (NEB ...
-
bioRxiv - Immunology 2021Quote: ... and 375 U/mL of Klenow Fragment (3’-5’ exo-) (NEB). After cDNA synthesis and subsequent purification by AMPure XP (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) and 1.5 µ l of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2022Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs). Illumina sequencing adapters were then ligated to DNA ends using Quick Ligase (New England Biolabs) ...
-
bioRxiv - Genetics 2019Quote: ... 3 U/µl T4 DNA polymerase (5 µl; New England Biolabs) and nuclease-free water (up to 100 µl) ...
-
bioRxiv - Genomics 2020Quote: ... EcoRI-HF (5’ GAATTC 3’) (New England BioLabs Inc., Ipswich, MA). gDNA samples that showed poor banding patterns or could not be digested by the enzymes listed above were then digested with Taq⍺I (5’ TCGA 3’ ...
-
bioRxiv - Systems Biology 2023Quote: ... and A-tailed using Klenow HC 3’ → 5’ exo (#M0212L; NEB).
-
bioRxiv - Microbiology 2023Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Genomics 2023Quote: ... and 2.5 U Klenow Fragment (3’ -> 5’ exo-) (New England BioLabs) and H2O to 20 μL ...
-
bioRxiv - Microbiology 2019Quote: ... 20 μg of total RNA were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) through a 16 h incubation at 16°C with 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of a mix containing 5 U of T4 RNA Ligase 2 (NEB), 1 mM ATP ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Mixes were subsequently digested 1h at 37 °C with DpnI (NEB) and used for electroporation in E ...
-
bioRxiv - Genomics 2019Quote: ... 5 μl of NEB Buffer 2 (New England Biolabs), 2 μl dNTP mix (2.5 mM) ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 5 ml 1x NEB Buffer 2 (NEB) and drop frozen in liquid nitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl Thermostable 5’App ligase (New England Biolabs), 4 μl 10 μM pre-adenylated R1R Adapter ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-monophosphate standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Apyrase (NEB). The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...