Labshake search
Citations for New England Biolabs :
451 - 500 of 4119 citations for 5 Bromo 2 3 dihydro 1H indole hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 8 candidate Envs containing variations of signature mutations were synthesized by Synbio Technologies and were cloned into the SHIV.3C backbone using the BsmBI restriction sites at the 5’ and 3’ end of the CH505 Env cassette and then ligated together using T4 ligase (New England Biolabs #M0202S). 8 plasmids encoding full-length SHIV.C.CH505 combination clones were used to transfect 293T cells as described above ...
-
bioRxiv - Molecular Biology 2023Quote: ... barcoded 5’ -pre-adenylated linkers were added to the 3’ ends of footprints using T4 Rnl2(tr) K227Q (New England Biolabs, M0351S), and excess unligated linker was removed using 10 U/µl 5’ deadenylase/RecJ exonuclease (Epicentre ...
-
bioRxiv - Molecular Biology 2023Quote: ... Small RNAs were treated with 5′ RNA polyphosphatase (Epicenter RP8092H) and ligated to 3′ pre-adenylated adapters with Truncated T4 RNA ligase (NEB M0373L). Small RNAs were then hybridized to the reverse transcription primer ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the pML104-GAL1 vector has a guide sequence 5’- CTCTTAAATTATAGTTGGTT-3’ introduced by Q5® Site-Directed Mutagenesis Kit (New England Biolabs) (Hu et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... and MpERF20 cds in situ R (5’ GTACAAGAAAGCTGGGTCGGCGCGCCttacatgagtgggggaactaaaagaagagt-3’) and seamlessly cloned using NEBuilder HiFi DNA Assembly (New England Biolabs, #E5520) into pENTR-D linearized with NotI/AscI ...
-
bioRxiv - Microbiology 2023Quote: ... and vcircRNA873/1151 (oligonucleotide probe 5’- CAGGACAACAGGGCCAGCAAGGTGGCGGACATCACAACCA-3’ against the junction) were performed using γ-32P-dATP-end labeled (PNK kinase, NEB) probes ...
-
bioRxiv - Genetics 2023Quote: ... 600 ng linearized plasmid backbone and 48 ng of digested library (molar ratio of 1:3) were ligated with 5 μL (2000 U) of T4 DNA ligase (NEB M0202S) in a 100 μL reaction ...
-
bioRxiv - Microbiology 2023Quote: ... The mixture was incubated for 3 days at 37C in the dark for conjugation and purified for 3 rounds using Monarch PCR & DNA Cleanup Kit (5 µg) (NEB, T1030S) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3.3 kb DNA sequence upstream of each respective gene was amplified using PCR and cloned into the vector containing the sequence gfp::rab-7::rab-7 3’UTR amplified from plasmid rgef-1p::gfp::rab-7::rab-7 3’UTR using PCR and primers 5’-atgagtaaaggagaagaacttttca-3’ and 3’-aagcttatcgataccgtcgac-5’ were used to generate tissue-specific gfp::rab-7::rab-7 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Molecular Biology 2019Quote: ... The 25mer Cap 1 RNA was generated by treating the chemically synthesized 3’-FAM-labeled Cap 0 25mer RNA with mRNA Cap 2’-O-Methyltransferase (NEB) in the presence of SAM ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 h at 37°C and IFITM3-iSNAP was stained with 3 µM SNAP-cell 647-SIR (New England Biolabs) at the same time ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pmex-5::PH-GFP-cyk-1(700-1437)::tbb-2 3’UTR in the pCFJ150 backbone [89] was made using HiFi cloning (New England Biolabs). Notably ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR product was either separated on a 2% agarose gel for 3 hours or digested overnight with MwoI (New England Biolabs) and separated on an agarose gel to determine individual fish genotypes ...
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q, New England Biolabs) at 22 °C for 3 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... 70 mM Tris-Hydrochloride (Tris-HCl, pH 7.6 at 25°C) and 1 U/µl T4 PNK (New England BioLabs). Reaction mixtures were incubated at 37°C for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... and was then installed with 5’cap (Vaccinia Capping System, NEB, USA; Cap 2’-O-methyltransferase, NEB, USA) and 3’ Poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... The doubly-digested vectors were assembled with a single fragment containing the ORF containing 5’ and 3’ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2020Quote: ... reverse primer S-D-Bact-0785-b-A-18 (5’ TAC NVG GGT ATC TAA TCC 3’) and a high fidelity Taq polymerase master mix (Q5, New England Biolabs, Massachusetts, USA). Primer sequences were based on Klindworth et al.24 ...
-
bioRxiv - Plant Biology 2021Quote: The purified PCR reaction was then A-tailed with 15 units Klenow Fragment (3’ – 5’ exo-) (New England BioLabs; Ipswitch, MA, USA) in 1X NEB Buffer 2 (New England BioLabs ...
-
bioRxiv - Cell Biology 2020Quote: ... of full-length SEC16A were generated by mutating 10 nucleotides in the silencer-select Sec16A siRNA (5’-CGGAGCUUCUGUUACGAGATT-3’, siRNA id: s19236, Thermo-Fischer Scientific) binding site using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) following manufacturer’s instructions.
-
bioRxiv - Biochemistry 2020Quote: ... or a control motif (5’-GGGACCCTGGGAGGG-3’) were prepared by viral replication using a helper phage M13K07 (New England BioLabs, Cat#N0315S). E.coli XL1-Blue cells were transformed with pBluescript SK(- ...
-
bioRxiv - Microbiology 2020Quote: ... the algR gene was amplified from gDNA using primers (algR-pUC-5, algR-pUC-3) and subcloned into pUC19 (New England Biolabs, Ipswich, MA). Site-directed mutagenesis was performed by amplification of pUC19::algR with primers (algR-D54E-Fw ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were then 3’dephosphorylated by denaturing at 65°C for 5 min and incubating with T4 PNK (NEB, catalog no. M0201S) in a 10 μL reaction (7 μL precipitated RNA ...
-
bioRxiv - Genetics 2022Quote: ... the homology 5’arm and 3’arm was amplified and linked to the pBS backbone with Gibson Assembly Kit (NEB, cat. no.E2611L) as ‘pBS-CG32814-arm’ ...
-
bioRxiv - Plant Biology 2022Quote: ... The doubly digested vectors were assembled with a single fragment containing the ORF containing 5′ and 3′ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... A repair template plasmid carrying the ~1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard NATR cassette inserted between the two flanks ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was A-tailed with Fermentas Klenow 3′ to 5′ exonuclease (Cat# EP0421) and ligated with adaptor oligonucleotides (NEB NEXT adaptor oligos) using Mighty Mix Ligase (Cat# TAK6023) ...
-
bioRxiv - Microbiology 2024Quote: ... A repair template plasmid carrying the ∼1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard HYGR cassette inserted between the two flanks ...
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...
-
bioRxiv - Biochemistry 2022Quote: ... Linearised plasmid was mixed with 2-3-fold excess of the three insert fragments followed by addition of Gibson Assembly® Master Mix (New England Biolabs) and incubation at 50°C for 60 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3′ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L). Linker-ligated footprints were reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Systems Biology 2019Quote: ... the Nickel-NTA beads were incubated in 80 μl 3’-linker ligation mix with (1 X PNK buffer, 1 µM 3’-adapter, 10% PEG8000, 30U Truncated T4 RNA ligase 2 K227Q (NEB, M0351L), 60U RNasin) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 0.5-1.0 μg of genomic DNA for each sample was heated at 65°C for 2-3 hours prior to digestion with PstI (New England Biolabs, UK). This enzyme has a 6 bp recognition site and leaves a 4 bp overhang ...
-
bioRxiv - Cell Biology 2019Quote: ... A preadenylated DNA adaptor sequence was ligated to the 3’-hydroxyl ends of the RNA fragments using T4 RNA Ligase (T4 RNA Ligase 2, truncated K227Q, NEB #M0351S). The ligated RNA product was reverse transcribed using Superscript III and a barcoded primer with sequence complementarity to the adaptor ...
-
bioRxiv - Molecular Biology 2021Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L). Linker-ligated footprints were reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L).
-
bioRxiv - Cell Biology 2024Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA ligase 2 truncated KQ (NEB, M0373L). Linker-ligated RNA was reverse transcribed with Protoscript II (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...