Labshake search
Citations for New England Biolabs :
1401 - 1450 of 4511 citations for 8 DECYLOXYPYRENE 1 3 6 TRISULFONIC ACID TRISODIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Regulation of skeletal muscle metabolism and contraction performance via teneurin-latrophilin actionbioRxiv - Physiology 2021Quote: ... The LPHN-1 and -3 genes were amplified by PCR and digested by T7 endonuclease using the EnGen Mutation Detection Kit (New England Biolabs) according to directions in combination with the custom primers that flank the appropriate CRISPR-targeting regions (Fig ...
-
bioRxiv - Biochemistry 2021Quote: ... purified RNA was dissolved in 3 μl RNase H reaction mix (1x RNase H buffer [NEB], 40 pmol oligo(dT)12 ...
-
bioRxiv - Microbiology 2021Quote: ... The insert possessing the additional A at 3’ end was ligated to the linearized vector with additional deoxythymidine (T) residues using T4 DNAligase (NEB). The plf gene cluster from strain QT598 (plfQT598 ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR product was either separated on a 2% agarose gel for 3 hours or digested overnight with MwoI (New England Biolabs) and separated on an agarose gel to determine individual fish genotypes ...
-
bioRxiv - Microbiology 2020Quote: ... A Ty tag DNA sequence was inserted at the 3’-end of the gat1 coding sequence using a Q5 site directed mutagenesis kit (NEB) and Fn and Rn primers ...
-
bioRxiv - Genetics 2021Quote: ... yoaALexAp1 5’-GCGCCCTCAT CCTGACATAA TGTCCCTTCA AATCAAGGGA CGGTAGTGTG ACGGAC-3’ and yoaALexAp2 5’-GTCCGTCACA CTACCGTCCC TTGATTTGAA GGGACATTAT GTCAGGATGA GGGCGC-3’ and amplification with the Phusion High-Fidelity DNA Polymerase PCR kit (New England BioLabs). Constructs were sequence verified.
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Microbiology 2021Quote: ... reverse: 5’-GATGGCGTGGAACCATGTC-3’) were obtained from the wild type plasmids pCMV-hnCoV-S via Q5 SiteDirected Mutagenesis Kit (NEB). pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward ...
-
bioRxiv - Microbiology 2020Quote: ... DNA encoding the HALO sequence was fused to that encoding the 3’-terminus of CFF1 using Gibson Assembly (New England Biolabs) (75) ...
-
bioRxiv - Developmental Biology 2020Quote: ... which was digested with Not1 and EcoR1 to accept two overlapping PCR fragments and a 1Kb 3’Arm by Gibson assembly (NEB). Aplnr (NM 011784.3 ...
-
bioRxiv - Immunology 2021Quote: Antisense DNA probes (Table S7) were synthesized at Metabion AG and 3’ mono-biotinylated using terminal transferse (New England Biolabs) and Biotin-11-ddUTP (Jena Bioscience ...
-
bioRxiv - Genetics 2020Quote: ... and T3 (5’-AATTAACCCTCACTAAAGGG-3’) promoter-tagged PCR fragment from each gene using corresponding T7 and T3 RNA polymerase (T3:M0378S; T7:M0251S, BioLabs). Primers used for PCR are listed in Supplemental table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... pCS2-luciferase CDS or pCS2-luciferase with G3BP1 5’UTR and 3’UTR were linearized with Sal I (New England Biolabs) and gel purified (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... The 3’ends of end-repaired DNA were extended with an A-overhang with 3’ to 5’ exonuclease-deficient Klenow DNA polymerase (NEB). The resulting fragments were ligated to Nextflex adapters (Bio Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... 5 µl of soluble lysate were incubated at 37 °C for 1 hour with 0.7 µM of a fluorescent ssDNA substrate (5′-ATT ATT ATT ATT CAA ATG GAT TTA TTT ATT TAT TTA TTT ATT T-fluorescein-3′) and 2.5 U of UDG (NEB #M0280) in a total reaction volume of 10 µl (diluted in reaction buffer) ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissue cultures that were cultivated on one filter membrane (3 cultures) were transferred as one sample into RNA Protection buffer (New England Biolabs) and RNA was isolated according to the manufacturer’s instructions (Monarch® Total RNA Miniprep Kit ...
-
bioRxiv - Microbiology 2022Quote: ... Backbone was amplified with primer pair 3/4 and fragments were assembled with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Molecular Biology 2022Quote: ... on-bead decapping and phosphorylation were performed in a 30 μl reaction with 5 units T4 PNK 3’ phosphatase minus (NEB), 2.25 μg GST-Dcp1-Edc1-Dcp2 ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Cell Biology 2022Quote: ... pDRF1-GW eCFP was made by performing a PCR with KOD One™ PCR Master Mix on AKAR3-EV with FW primer 5′-ATGCTAGCATGGTGAGCAAGGGCG-3′ and RV primer 5′-TAGCGGCCGCTTACTTGTACAGCTCGTCCATGCCG −3′ after which the PCR product and pDRF1-GW were digested using NheI-HF and NotI-HF (New England Biolabs). Finally ...
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...
-
bioRxiv - Immunology 2022Quote: ... Beads were washed and resuspended in NEBuffer 3 containing Calf Intestinal Alkaline Phosphatase at a concentration of 0.5 U/μl (NEB, M0290) to dephosphorylate the RNA ...
-
bioRxiv - Genetics 2022Quote: ... I23A was introduced at the same time with GFP knock-in by incorporating the corresponding mutation in the 3’ homology arm on the repair template plasmid using the Q5 site-directed mutagenesis kit (New England Biolabs). GermLine Optimized mScarlet-i sequence (Fielmich et al ...
-
bioRxiv - Genetics 2022Quote: ... 5 ’TTAGCTCTTAAAC NNN…NN NCCAACAAG 3’) and ligating them together with the linearized vector using the T4 DNA ligase enzyme (NEB). Cloning of sgRNAs in a multiguide expression system (SP199 ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Plant Biology 2022Quote: ... Four vectors including one of the active 5′gRNA-pairs and one of the active 3′gRNA-pairs were digested by BglI (New England Biolabs) and ligated at once ...
-
bioRxiv - Molecular Biology 2022Quote: ... The RNA was then end-repaired with 20 U of 3’-phosphatase-positive bacteriophage T4 polynucleotide kinase (T4 PNK; New England Biolabs), using conditions recommended by the supplier (1× PNK buffer without ATP ...
-
bioRxiv - Microbiology 2022Quote: ... then 3’-adenylated and NEXTflex HT Barcodes (Bio Scientific Corporation) were added using NEBNext DNA modules products (New England Biolabs). After two consecutive cleanups with 1×AMPure XP ...
-
bioRxiv - Pathology 2022Quote: ... A targeting vector with P2A-CreERT2-T2A-GFP-stop codon-rabbit beta globin polyA sequence flanked by 5’ and 3’ homology arms was generated using NEBuilder HiFi DNA Assembly (NEB) and cloned into a pKO2 backbone plasmid ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Beads were then dried before adding 50 µL DNaseI mix (3 U of DNaseI in 1X DNAse buffer (NEB, #M0303L) and incubated at 37 °C for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a synthetic 391 bp double-stranded DNA fragment encoding 5′-(1st gRNA/scaffold/H1 promoter/2nd gRNA)-3′ was inserted using the NEBuilder HiFi assembly system (NEB). Synthetic DNA fragments were ordered from Genewiz and sequences are listed in Supplementary Table 3 ...
-
bioRxiv - Systems Biology 2023Quote: Mutated or wild type sequences of RORC 3’UTR were cloned into the dual GFP-mCherry reporter using MluI-HF and PacI restriction enzymes (NEB) as described above ...
-
bioRxiv - Genomics 2022Quote: ... pJR98 was digested by AscI and ssDNA oligo donors of the sequence 5’ CTCTTCCTGCCCGACCTTGGGG – reverse complement IBC – CAGCGCCATAGCTGAGTGTAGATTCGAGC – 3’ were cloned into the vector using NEBuilder HiFI DNA Assembly Master Mix (NEB). Third ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 nM RNAse-free DNA fragments containing gRNA target sequences and 30 nM Cas9 or Cas12a protein (NEB, Ipswich, MA) were mixed in reaction tubes as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... IVT RNA products (2×10-3 dilution) were tested for absence of carry-over plasmid template by PCR using Taq 2X master mix (NEB). A negative PCR result would confirm the absence of carryover plasmid in the IVT product.
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was treated with RNase H before second-strand synthesis by Klenow fragment (3′ to 5′ exonuclease) (New England Biolabs), then the double-stranded cDNA was sheared into average of 200 bps fragments using a Covaris focused ultrasonicator E210 ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’) was ligated to the 5’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Molecular Biology 2022Quote: ... were annealed to an oligonucleotide containing the antisense of the 3’ restriction site (5’-GGT TGA TTA TCG ATA AGC TT-3’) and extended using Klenow Polymerase devoid of exonuclease activity (NEB). Resulted fragments were inserted into the pAAV-CAG-hFXN plasmid between the stop codon of the hFXN and poly A signal ...
-
bioRxiv - Synthetic Biology 2022Quote: ... or PCR amplified using primers that anneal to the 5’ or 3’ ends of each chunk with Phusion polymerase (New England Biolabs). Plasmid digested or PCR amplified chunks were excised from agarose gels or column purified ...
-
bioRxiv - Plant Biology 2022Quote: ... The entry module pGG-B-AtU6-26-BRI1-2-C and pGG-A-AtU6-26-BRI1-3-B were generated by annealing oligos for each gRNA and ligating into BbsI-digested (New England Biolabs) Golden Gate entry vectors described in (66) ...
-
bioRxiv - Physiology 2022Quote: RNA-sequencing libraries were prepared by depleting eukaryotic ribosomal RNA with the NEBNext rRNA Depletion Kit prior to library synthesis with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina and addition of multiplex oligos using the Unique Dual Index Primer Pairs Set 3 (NEB). Library quality control was performed using Qubit and Bioanalyzer 2100 ...
-
bioRxiv - Microbiology 2022Quote: ... the pulL gene was PCR-amplified from plasmid pCHAP8258 as template using primers PulL Kpn 5 and PulL Eco 3 with the high-fidelity Q5 DNA polymerase (New England Biolabs). The PCR products were purified on a Qiaquick spin column ...
-
bioRxiv - Cell Biology 2022Quote: ... The 3′ end of the fragmented RNA was dephosphorylated with T4 polynucleotide kinase (PNK, New England Biolabs, Ipswich, MA, USA) followed by heat-inactivation ...
-
bioRxiv - Microbiology 2023Quote: ... The library preparation including an enrichment step for 5’-triphosphorylated RNAs by capping the RNAs with 3’-desthiobiotin-TEG-GTP (NEB) [15] and subsequent deep sequencing on a Illumina NextSeq 500 system with 75 bp read length were conducted at Vertis Biotechnologie (Germany ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 3 µL of the assembly product was used to transform 65 µL of T7 Express chemically competent cells (NEB #C2566I) according to the manufacturer’s high-efficiency transformation protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... Deletions within the nhr-23 3′ UTR reporter (cloned in pHR017) were created using a Q5 Site-Directed Mutagenesis Kit (NEB) and verified by Sanger Sequencing (Genewiz Inc.) ...
-
bioRxiv - Microbiology 2023Quote: ... an ‘A’ base was added to the 3’ end of the blunt-end phosphorylated DNA fragments using the polymerase activity of Klenow (Exo-Minus) polymerase (NEB); Illumina genomic adapters were ligated to the A-tailed DNA fragments ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... while the pML104-PDR1 vector has a guide sequence 5’- CTGGATAAACGTCGCTCCAC-3’ introduced by Q5 polymerase PCR (New England Biolabs) and In-Fusion Snap Assembly (Takara ...
-
bioRxiv - Cell Biology 2023Quote: ... Donor sequences were then inserted at the HindIII (5’) and XhoI or BamHI at (3’) sites using HindIII-HF and XhoI-HF or BamHI-HF (New England Biolabs).