Labshake search
Citations for New England Biolabs :
1651 - 1700 of 4511 citations for 8 DECYLOXYPYRENE 1 3 6 TRISULFONIC ACID TRISODIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... 1 U/μL T4 RNA ligase 1 (New England Biolabs), 1.3 U/μL Ribolock RNase inhibitor (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... 1 ul i7 and 1 ul i5 (from NEB #E7600S), 8 ul 1st PCR product after SPRI beads ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:100 or 1:1000 (stock 10 mg/mL, NEB) or with 1:10 Dnase I (stock 2 U/μL ...
-
bioRxiv - Biophysics 2022Quote: ... 1 µL of 0.4 µg µL-1 Lys-C (NEB) stock was added (enzyme:substrate ratio of 1:100 w/w ...
-
bioRxiv - Cancer Biology 2023Quote: ... and digested briefly (< 1 min) by 1% Proteinase K (NEB) in TE buffer at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μL purified TS2126 and 1 μL PAP1 enzyme (NEB) in 7 μL Ezra buffer) ...
-
bioRxiv - Molecular Biology 2023Quote: ... then 1 U of T7 endonuclease 1 (New England Biolabs) and NEB Buffer 2 were added ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:50,000 (NEB, and anti-GST HRP conjugates ...
-
bioRxiv - Genomics 2022Quote: ... and then ‘A’ base was added to 3’ blunt ends using the A-Tailing reaction (NEBNext® UltraTM II End Repair/dA-Tailing Module, NEB, Cat. E7546). The purified A-tailed DNA was ligated with adaptors from the Ligation Sequencing Kit (SQK-LSK109 ...
-
bioRxiv - Genomics 2019Quote: ... 3 μg RNA was used to generate sequencing library by using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA). PCR was carried out using Phusion High-Fidelity DNA polymerase ...
-
bioRxiv - Neuroscience 2019Quote: ... The cassette was amplified by PCR then ligated to the donor template using Gibson Assembly Master Mix (NEB, primers in Supplementary Table 3). The reaction was incubated at 50 °C for 15 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... a non-adenylated 3’ adapter was ordered for chemical synthesis from IDT™ and adenylated with the 5’ DNA Adenylation Kit (New England Biolabs® Inc.) (see Supplemental Table 4 for primers and adapters used) ...
-
bioRxiv - Cell Biology 2022Quote: Living ovaries were incubated at room temperature in SNAP solution containing 3 μM SNAP- Cell TMR-Star or SNAP-Cell 647SiR (New England BioLabs, S9105S and S9102S), 10% FCS and 0,2 mg/ml Insulin in Schneider’s medium ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µl murine RNase inhibitor per sample and 3 µl were added to each sample together with 2 µl truncated T4 polynucleotide kinase (#M0201, NEB; Frankfurt/Main, Germany). Samples were incubated for 2 h at 37°C and the enzyme was deactivated after the reaction by 10 min incubation at 75°C ...
-
bioRxiv - Zoology 2021Quote: ... a total of nine RNA libraries were prepared with 3 μg RNA using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection of editing in the EBE region of CsLOB1 promoter was performed by amplifying the target region (primers in Supplementary Table 3) with high fidelity DNA polymerase Q5 (New England Biolabs, Ipswich, MA, USA), followed by cloning of PCR products and sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... digoxigenin-11-ddUTP was added to the 3’ end of the digested fragments using terminal transferase enzyme (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Microbiology 2023Quote: ... The upstream and downstream PCR products were designed to have an overlapping region of sequence to promote 3-part Gibson assembly (NEB Gibson assembly kit) and primers 5b and 4 had extensions to anneal to vector pMP62 ...
-
bioRxiv - Molecular Biology 2023Quote: All PolD mutants (Supplementary table 3) were generated using pLB047 and a Q5 Site-Directed mutagenesis kit (E0554 New England Biolabs Inc., Ipswich MA) as described by the manufacturer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The inserted barcoding sequences were annealed using randomized overlapping single stranded oligonucleotides by adding 3 µl of each oligonucleotide (100 µM) to 500 µl 1x 2.1 NEB-buffer (New England Biolabs, Ipswich, MA, USA, #B6002S) followed by boiling at 100 °C for 3 minutes to finally let them associate during the cooling to room temperature ...
-
bioRxiv - Physiology 2024Quote: ... and PCR was performed with Flag F (caaggacgacgatgacaaagtc) + 3’OUTR (CAGAGCCAACAACGTGAGGT) primers using Q5® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... hereafter called Flag-SERCA2-C) were constructed from 3×Flag-SERCA2 using a Q5 Site-Directed Mutagenesis Kit (New England BioLabs, Ipswich, MA, USA). mCherry-Sec61B (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... 3 ug RNA was treated with Promega RQ1 DNase (M6101) then cleaned up with the Monarch® RNA Cleanup Kit (NEB Biolabs, T2050S) and eluted in 30 µl dH2O.
-
bioRxiv - Microbiology 2020Quote: ... followed 1 hr recovery in 1 mL pre-warmed SOC (NEB) at 37°C 250 rpm ...
-
bioRxiv - Biochemistry 2019Quote: ... 1/20-1/50 (w/w) GluC protease (New England BioLabs) was added and incubated 24-48 h at 4°C ...
-
bioRxiv - Biophysics 2021Quote: ... The chamber was incubated with 1 mg ml−1 streptavidin (NEB) and washed with MBCT ...
-
bioRxiv - Microbiology 2020Quote: ... 1 U of DNase 1 (New England Biolabs, Ipswich, MA US) per ∼100 µl lysate (37°C ...
-
bioRxiv - Biophysics 2023Quote: ... 1 μl Cutsmart buffer and 1 U Sau96I (New England Biolabs) were added into the system ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 μl of SUPERase_In and 1 μl of T4 PNK (NEB)) and incubated at 37 °C for 1 hr ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 unit/µl T4 RNA ligase 1 (New England Biolabs, M0204S) and incubated at 23°C for 150 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were mixed 1:1 with 2x RNA dye (NEB B0363S), loaded on TBE gels ...
-
bioRxiv - Biochemistry 2024Quote: ... 100 μL of 1 unit mL-1 SfoI restriction enzyme (NEB) was injected to generate blunt-end DNA molecules.
-
bioRxiv - Biochemistry 2020Quote: ... Diatom exconjugants were selected on 1/2L1 1% agar medium supplemented with 20 μg mL−1 phleomycin (Gold Biolabs) at a diel cycle of 14:10 at ~50 μE ms−1 light intensity.
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg non-methylated NEAT1_1 IVT product was radio-labelled with radioactive labelling mix (1 µL 10x PNK buffer, NEB, 1 µL NEAT1_1 IVT product, 1 µL T4 PNK, NEB, 1 µL γ-32P-ATP ...
-
bioRxiv - Microbiology 2020Quote: ... PCR protocols entailed an initial phase of 95° C for 3 min using Hot Start Taq polymerase (New England BioLabs Inc., Ipswich, MA, USA), followed by 35 cycles at 50°C and 52°C annealing temperatures for 16S and ITS amplicons respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries were generated from a total amount of 3 μg RNA per sample using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Genomics 2022Quote: ... and for the synthesis of the second strand of cDNA was used the Klenow fragment 3’-5’ exo (New England Biolabs Inc., Ipswich, MA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 100 ng of DNA was cleaved with PstI HF and MseI restrictases in CutSmart® buffer (New England Biolabs; 3 hours at 37°C). P1 and P2 barcoded adapters corresponding to the restriction site of the enzymes were ligated immediately afterwards with T4 ligase (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were resuspended in 50 mL buffer 3 (20mM KPi pH 7.4, 1.2M Sorbitol, 10 mM ribonucleoside vanadyl complex (NEB S1402S, pre-warmed at 65 °C), 0.08mg/ml Zymolyase-20T (Amsbio 326921) ...
-
bioRxiv - Microbiology 2024Quote: ... 5’-GCT GCG TTC TTC ATC GAT GC-3’) were chosen with barcodes for PCR amplification using Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA, USA). The PCR products were then mixed at equal density ratios and purified with a Gel extraction kit (QIAGEN ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1× NEB 1 buffer, 1% triton X-100, and 100 U HpaII enzyme [NEB]) and incubated at 37 °C for 3 hours with constant shaking ...
-
bioRxiv - Genomics 2019Quote: ... the fragmented genomic DNA was ligated with 1 µL of 10 µM phosphorylated hairpin oligo mix (1 µL of NEB T4 ligase, 1 µL of 10x NEB T4 Ligase buffer ...
-
bioRxiv - Microbiology 2020Quote: ... using separate template dilutions (1:1 & 1:10) and high-fidelity Phusion polymerase (New England BioLabs Inc., Ipswich, MA, USA). A single round of PCR was performed using “fusion primers” (Illumina adaptors + indices + specific regions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proximity ligation was performed using 1 unit/ml RNA ligase 1 (NEB), 1x RNA ligase buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The cells were resuspended in 1 mL of 1× NEBuffer 2.1 (NEB) and homogenized by grinding to a fine powder in liquid nitrogen ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mM phenylmethylsulfonyl fluoride (PMSF) and 1 x Protease Inhibitor Cocktail (NEB) as described before (Sun et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 μg of amilCP_Orange chromoprotein was digested with 1 μL PflMI (NEB) with r3.1 buffer (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μl of 20,000 U.ml−1 exonuclease I (New England Biolabs M0293) and 5 μl of 10X exonuclease I buffer (New England Biolabs B0293S ...
-
bioRxiv - Biochemistry 2021Quote: ... 100 μM ATP including 1 unit/μL T4 RNA ligase 1 (NEB) (final volume 300 μL ...