Labshake search
Citations for New England Biolabs :
1401 - 1450 of 2005 citations for 7 Iodobenzofuran 5 sulfonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 5’end of RNA was phosphorylated and labelled by γ-[32P] ATP using T4 Polynucleotide Kinase (New England Biolabs) at 37°C for 45 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 (1) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). In addition ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads were then washed once in 5 volumes of binding buffer (100μL, 1xPBS containing 1mg/mL of BSA (NEB)) for 10 minutes at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4(wACBD5_FFAT)/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Cancer Biology 2020Quote: ... pre-existing histones were first quenched by incubating cells with 5 µM SNAP-cell Block (New England Biolabs; S9106S) for 30 min at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Selectively captured polyadenylated RNAs (1μg) were ligated directly to an DNA/RNA hybrid adapter (5’-CTACAC GACGCTrCrUrUrCrCrGrArUrCrUrNrNrN-3’) using T4 RNA ligase (NEB) at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... or RCC970 in 50 μl total volume containing 5 μl 10x Q5 Reaction Buffer (NEB, Frankfurt am Main, Germany), 0.5 U of Q5 High-Fidelity DNA Polymerase (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: Every single stranded oligonucleotide (1 nmol) was 5’-end-phosphorylated with 40U of T4 Polynucleotide kinase (New England Biolabs) by incubation at 37°C in 1x T4 DNA Ligase Reaction Buffer.
-
bioRxiv - Biochemistry 2020Quote: ... 14 nucleotides in length (TIBMOL BIOL, Berlin) were radioactively phosphorylated with [32γP] dATP at their 5’ ends using phosphokinase (NEB) following the manufacturer protocol and used as a length standards.
-
bioRxiv - Molecular Biology 2022Quote: ... Up to 5 μg of gDNA was digested with 15 U of SalI-HF® enzyme (NEB, Cat# R3138L) for 3 hr at 37°C and separated on 0.9% agarose gel for 16 hr at 50 V ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The total volume reaction was 25 μl with the following composition: 5 μL 10× buffer at 1.0 mM (New England BioLabs), 0.1 mM each dNTP ...
-
bioRxiv - Biochemistry 2019Quote: ... All sens RNA strands were labeled at their 5’ end with [γ-32P] ATP using protein nucleotide kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... was hybridized to the 3’ adapter and the 5’ adapter ligated by adding 2μL T4 RNA ligase buffer (NEB), 5μL PEG 8000 (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... The PCR product was inserted into pcDNA3.1 via 5’EcoRI/3’NotI restriction digestion and a standard ligation protocol (T4 DNA Ligase; New England BioLabs) to create pcDNA3.1-Ncadherin ...
-
bioRxiv - Genetics 2020Quote: ... the beads were resuspended in 75 μL of ChIP Dilution Buffer and 5 μL of BSA (New England BioLabs) and incubated at 4°C overnight with rotation for blocking ...
-
bioRxiv - Microbiology 2020Quote: ... and the 5’ ends of the DNA (25 nM) were radiolabeled using T4 polynucleotide kinase (PNK, New England Biolabs). Excess ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μM of each forward and reverse primer (Supplementary Table 1) and 2.5 U Long Amp Taq Polymerase (NEB) in a total volume of 25 μL ...
-
bioRxiv - Microbiology 2021Quote: ... DNA oligonucleotides (Supplementary Table 2) were radiolabeled at the 5’ end by T4 Polynucleotide kinase (PNK) (New England Biolabs) treatment and [γ-32P] (PerkinElmer ...
-
bioRxiv - Bioengineering 2019Quote: The pcDNA 3.1 NCadTS expression construct was generated using overlap extension PCR [5] using Phusion Polymerase (New England BioLabs). The forward and reverse primers 5’ CCA CAG TAC CCA GTC CGA TCC GCA GCC ATG GTG AGC AAG GGC GAG GAG ACC ACA ATG GGC 3’ ...
-
bioRxiv - Genomics 2021Quote: ... Ligation was done overnight at 16°C also rotating at 900rpm for 10 seconds every 5 minutes by adding 120μl of 10X ligation buffer (NEB), 664μl water ...
-
bioRxiv - Biochemistry 2021Quote: ... The mixture was incubated at room temperature for 10 min followed by transformation into 5-alpha competent cells (NEB). The E ...
-
bioRxiv - Bioengineering 2020Quote: ... Then 5 μl extracted RNA was fragmented at 94°C for 9 minutes by using 0.2× fragmentation buffer (NEB) before conducting the nanoswitch detection ...
-
bioRxiv - Biochemistry 2021Quote: ... Construct included 5’ and 3’ complementary overhangs for ligation into pPICZαA using NEBuilder HiFi DNA Assembly (New England Biolabs) to form pPICZαA_GH43_34 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Ligation was done overnight at 16°C also rotating at 900rpm for 10 seconds every 5 minutes by adding 120µl of 10X ligation buffer (NEB), 664µl water ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 5 µL of the ligation mixture was added to 50 µL of chemically competent NEB10β cells (New England Biolabs) and transformation was performed following manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... and plasmid IRES sequence (IRES_rev) using 5% of the genomic DNA as a template and Q5 polymerase (New England Biolabs - NEB) at 100 μL scale ...
-
bioRxiv - Plant Biology 2021Quote: ... samples were incubated for 5 min on ice and 3 μL of 10X G5 buffer (New England BioLabs, UK) were added to the samples together with 1.5 μL of 25X concentrated protease inhibitor cocktail (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris-PAGE and transferred to a nitrocellulose membrane (Protran) ...
-
bioRxiv - Microbiology 2021Quote: ... and npmA F and npmA_R, respectively (Table S5) Assembled vectors (Figs. S4C, S4D) were transformed into NEB 5-alpha (New England Biolabs), selecting for ampicillin and gentamicin resistance ...
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Genomics 2020Quote: ... Capture plate wells contained 5 µl of capture solution (1:500 Phusion High-Fidelity Reaction Buffer, New England Biolabs; 1:250 RnaseOUT Ribonuclease Inhibitor ...
-
bioRxiv - Genomics 2022Quote: ... a total of 100 ng of SED vector construct was digested with 5 U of I-SceI meganuclease (NEB) at 37°C for 10 minutes in a 10 μL reaction mixture ...
-
bioRxiv - Bioengineering 2022Quote: ... the 5S and Saba PCR products were purified using Monarch® PCR & DNA Cleanup Kit (5 μg) (NEB, # T1030). The purified DNA sequence was then analyzed through Sanger sequencing (GENEWIZ from Azenta ...
-
bioRxiv - Cancer Biology 2022Quote: ... new SNAP-tagged histones were pulse-labeled for 30 min with 5 μM final SNAP-biotin (New England Biolabs) diluted 1:200 in 10% Duolink blocking buffer (Sigma-Aldrich ...
-
bioRxiv - Genetics 2022Quote: ... 1 µL of extracted genomic DNAs and 5 µL of 2× Hot Start High Fidelity Q5 Master Mix (NEB). PCR reactions were carried out under the following condition ...
-
bioRxiv - Zoology 2023Quote: ... We performed 5 PCR enrichment with 15 cycles (30 ng DNA input, NEB Phusion High-Fidelity PCR Master Mix) for each library to increase fragment diversity ...
-
bioRxiv - Molecular Biology 2022Quote: ... The total isolated gDNA was processed in batches of 5 µg per PCR reaction with Q5 polymerase (NEB M0491L). One PCR reaction contained 10 µl 5x reaction buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... the fragment and vector were mixed in a 5:1 ratio and ligated with T4 DNA Ligase (NEB, M0202L) overnight at 16°C ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Genomics 2023Quote: The standard HiDEF-seq v2 protocol was followed with the exception of replacing Klenow fragment 3’→5’ exo-polymerase with one of the following: 9.6 U Bst large fragment (NEB), 9.6 U Bst 2.0 (NEB) ...
-
bioRxiv - Genetics 2023Quote: ... were ligated overnight at 20°C with a mix of six 5’ phosphorylated telorette oligonucleotides (0.1 µM each) and 2,000 units of T4 ligase (NEB Inc.) in a 50 µl reaction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µL of the assembly product was used to transform 50 µL of DH5α chemically competent cells (NEB #C2987I) according to the manufacturer’s high-efficiency transformation protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the second linker SI183 5’-/Phos/NNAGATCGGAAGAGCGTCGTGTAGGGAAAGAG/ddC/-3’ was preadenylated by Mth RNA Ligase (New England Biolabs) as described previously8 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and was cloned into PCW57.1 at the 5’ BSRGI and 3’ BAMHI restriction sites using NEBuilder HIFI DNA Master Mix (New England BioLabs).
-
bioRxiv - Genomics 2023Quote: ... A mono-phosphate group was then added back to the 5’-end of RNAs by polynucleotide kinase (PNK, NEB) in the presence of 10mM ATP ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were pelleted at 500 x g for 5 minutes and resuspended in 8µg/mL recombinant albumin (New England Biolabs) in dPBS-/- ...
-
bioRxiv - Plant Biology 2023Quote: The m6A immunoprecipitation was performed from 5–day–old seedlings using the EpiMark® N6–Methyladenosine Enrichment kit (NEB) starting from 4 μg of total RNA ...
-
bioRxiv - Immunology 2023Quote: ... were single-cell sorted into 5 µl 1% (v/v) Nonidet P40 Substitute, Tris-HCl (20 mM, pH 8.0) containing 5 U murine RNase inhibitor (NEB) using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Developmental Biology 2023Quote: ... was generated from full-length CSN-5 using a Q5 site-directed mutagenesis kit per manufacturer’s instructions (New England BioLabs). Truncated CSN-5 constructs were made by PCR from full-length CSN-5 and inserted into pGEX-KG plasmids ...