Labshake search
Citations for New England Biolabs :
1351 - 1400 of 2005 citations for 7 Iodobenzofuran 5 sulfonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... using ETAA1 DBR R1 RT-PCR primer 5′-AAGTTCTTCTTCTTGACTTTGTGTT-3′ and treated with RNaseH (New England Biolabs, M0297S). 1μl of the cDNA was used for PCR amplification reactions using using GoTaq® G2 DNA Polymerase (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by addition of a phosphate group to the 5’ end using T4 polynucleotide kinase (T4 PNK, NEB). Next ...
-
bioRxiv - Cell Biology 2023Quote: ... A stock solution of these oligos (1μl of a 10μM) was 5’-end-labeled using T4PNK (NEB®) and 5μl of ATP ...
-
bioRxiv - Genomics 2023Quote: ... DNA was then pre-amplified 5 cycles with NEBNext Ultra II Q5 master mix (New England Biolabs, M0544) with a cycling protocol of 72°C for 5 min ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 µl of 100 mM dATP solution and 2.5 µl of Klenow Fragment (3′->5′ exo-) (NEB, #M0212L) were added to the mixture ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.5 μL BsaI-HF® v2 NEBridge® Golden Gate Assembly mix (E1601, NEB, 5 μL final volume), and 0.5 μL T4 DNA ligase buffer was aliquoted across a PCR plate ...
-
bioRxiv - Biochemistry 2023Quote: ... dynein-bound beads were mixed with 5 µM SNAP-Cell-TMR or SNAP-AlexaFluor-647 (New England Biolabs) for 10 min at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 µl 100× Protease inhibitor cocktail and 1 µl of CviKI-1 (5 U/100,000 nuclei, NEB R0710S) were added ...
-
bioRxiv - Cell Biology 2023Quote: ... For an R-loop negative control the preparation was treated with 5 U RNaseH (M0297S, NEB Japan, Japan) in 1× RNaseH Reaction Buffer (NEB Japan ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligonucleotides corresponding to the ‘right’ half were 5′-phosphorylated using T4 polynucleotide kinase (New England Biolabs, Ipswitch, MA). Equimolar amounts of ‘right’ strand ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by on-bead 5’ ligation of a biotinylated REL5 linker sequence using T4 RNA ligase 1 (NEB) for 3 h at 37⁰C ...
-
bioRxiv - Molecular Biology 2023Quote: ... three 25 μl PCR reactions were pooled and purified using Monarch PCR & DNA Cleanup Kit (5 μg; NEB), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli strain MET961 was constructed by replacing the glgB gene of strain NEB 5-alpha (New England Biolabs) with the glgB::Kan-pWV01repA region from E ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of the polyC-tailed products were used with 1X Taq Mg-free Buffer (New England Biolabs), 500 nM of each primer (Table 2) ...
-
bioRxiv - Genomics 2023Quote: ... 2 εL of 10% Tween-20 and 5 εL NEBNext High-fidelity 2× PCR Master Mix (NEB, M0541) was added to each well sequentially ...
-
bioRxiv - Molecular Biology 2024Quote: ... the samples were washed three times for 5’ each with PBS-0.01%Tween and incubated with 0.24 mg/ml Monarch RNase A (New England Biolabs) for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... The fragments were re-phosphorylated at their 5’-hydroxyl groups using T4 polynucleotide kinase (New England Biolabs; M0201S) and purified using the miRNeasy Mini Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg total RNA was subjected to poly(A) mRNA isolation according to the manufacturer’s protocols (NEB, #E7490). Then ...
-
bioRxiv - Cancer Biology 2024Quote: ... A single adenine base was added to fragment ends by Klenow fragment (3′ to 5′ exo minus; NEB), followed by ligation of Illumina adaptors (Quick ligase ...
-
bioRxiv - Cell Biology 2024Quote: ... washed and incubated with T cell medium containing 5 μM (Snap-Cell Block S9106S, New England Biolabs, NEB) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... washed and incubated with T cell medium containing 5 μM (Snap-Cell Block S9106S, New England Biolabs, NEB) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM MgCl2) and either 25 nM NudE.1 WT or NudE.1 E64,65Q or NudC WT (NEB). For NAD spike-in kinetics ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μl of 10 mM MnCl2 and 1 μl (400 units) of λPP (New England Biolabs, Ipswich, MA). Untreated lysates received 1 μl of H2O in place of λPP ...
-
bioRxiv - Microbiology 2020Quote: ... and a “bottom” strand with sequence 5’-AAAAC-(30bp spacer reverse complement)-3’ were phosphorylated with PNK (NEB, M0201S) in a 50 μL reaction volume (1.5 μL 100 uM top oligo ...
-
bioRxiv - Genetics 2021Quote: ... Tagmented library was amplified with P5_BRB and BRB_Idx7N5 primers (5 μL, Supplementary Table 14) using NEBNext UltraTM II Q5 Master Mix (NEB, M0544L) which was incubated at 98 °C for 30 sec before adding DNA with the following conditions ...
-
bioRxiv - Genetics 2021Quote: ... and 420μl H2O with 1 hr incubation at room temperature and then subjected to proximity ligation by adding 200μl 5× ligation buffer (B6058S, NEB), 6μl biotinylated bridge linker (200ng/ul) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... at 50°C for 60 min with a subsequent Klenow DNA polymerase step using 5 units (New England Biolabs) at 37°C for 60 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Molecular Biology 2021Quote: The RNA primer was labelled at the 5’ terminus with [γ-32P]ATP using T4 PNK (New England Biolabs) and PAGE purified ...
-
bioRxiv - Molecular Biology 2021Quote: ... eight rounds of linear amplification PCR reactions with 40μg genomic DNA were performed with 5 μg genomic DNA each using HS Flex polymerase (NEB) and biotinylated Myc primer (Table S2) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 µl of 10x RNase H reaction buffer and 1 µl (5 units) of RNase H (New England Biolabs) were added to 8 µl of the reaction mixture and incubation was continued for another 30 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris-PAGE ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... were radiolabeled at the 5’-end with 32P using the manufacturer recommended protocol for T4 PNK (New England Biolabs) and ATP [g-32P] (Perkin Elmer) ...
-
bioRxiv - Biochemistry 2020Quote: ... Approximately 5 μg of each PcCel6A mutant gene in pPICZα was linearized by restriction enzyme PmeI (New England Biolabs) for the transformation of P ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ end of the digested RNA is then labelled with 10 U T4 PNK (New England Biolabs M0201) and 10 µCi [γ-32P]ATP (Perkin Elmer BLU002Z250UC ...
-
bioRxiv - Plant Biology 2021Quote: ... Digested DNA was ligated during 5 h incubation at 16 °C with 100 U of T4 DNA ligase (NEB). DNA was recovered after reverse crosslinking and Proteinase K treatment (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... The holder allowed immersion of the cochlea and the middle ear in oxygenated (95 % O2, 5 % CO2) cell culture medium (Minimum Essential Medium with Earle’s balanced salts, SH30244.FS Nordic Biolabs). The bone of the bulla was removed gently with bone cutters which exposed the middle ear and the basal turn of the cochlea ...
-
bioRxiv - Biochemistry 2021Quote: ... 2.5 μl of reaction was added to a tube containing 5 μl replication buffer and 1 μl MseI (NEB) for 3 min ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 μg of total RNA was purified using the Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, Massachusetts). Libraries were constructed using the ULTRA II directional library kit (New England Biolab ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in 18.5 μL T4 DNA Ligase Reaction Buffer with 5 μL of 10 μM annealed Broken end linker and 1.5 μL T4 DNA Ligase (#M0202S, New England Biolabs). The reaction was incubated 18-20 h at 16°C with constant mixing ...
-
bioRxiv - Cancer Biology 2021Quote: ... We performed 5 or 20 Gibson assembly reactions for tiling or genome-wide sgRNA library followed by manufacturer’s instructions (NEB) and purified DNA using ethanol precipitation ...
-
bioRxiv - Genomics 2022Quote: ... A circular form of the 3I_RAN FLEXI synthetic oligonucleotide control was generated by incubating the 5’phosphorylated-3I_RAN FLEXI oligonucleotide (500 ng) with T4 RNA Ligase I (10 U; New England Biolabs) for 2 h at 25 °C and 2 min at 95 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions contained approximately 5 μL of isothermal assembly mix (prepared similar to as previously described12) or NEBuilder HiFi (NEB), 0.01 pmol of plasmid linearized via SpRYgest ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ end of the first block and the 3’ end of the last block contained SapI (NEB, R0569) recognition sites instead ...
-
bioRxiv - Genomics 2022Quote: ... Cells were fixed with 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized for 5 min on ice in PBS containing 0.5%Triton X-100 and 2mM Vanadylribonucleoside complex (New England Biolabs). Coverslips were preserved in 70% EtOH at -20°C ...