Labshake search
Citations for New England Biolabs :
1351 - 1400 of 7667 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... coli MG1655 genomic DNA into pKK223-3 by NEBuilder HiFi DNA Assembly Cloning Kit (NEB) and the first 300 bp portion of leuA was translationally fused with the nano-Luc (nLuc ...
-
bioRxiv - Genomics 2022Quote: ... dA was added to the 3’-end of DNA using Klenow fragment exo- (NEB: M0212S) and then the adapter was ligated to the end of DNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ ligation (on-bead) with a barcoded RNA adapter followed using T4 RNA Ligase (NEB). Samples were again stringently washed ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the 3’ homology arm were produced by PCR (Phusion DNA polymerase, New England Biolabs). The 5’ and 3’ homology arm DNA fragments were amplified from genomic DNA prepared from vasa-Cas9 flies ...
-
bioRxiv - Cell Biology 2020Quote: ... and 3 µg/ml leupeptin were incubate with 17.5 U alkaline phosphatase (New England Biolabs) at 37°C for 1 h ...
-
bioRxiv - Genomics 2021Quote: ... to 3’-P presenting in the RNA that was dephosphorylated using T4 PNK (NEB, #M0201S). Linker and RNA ligation was performed by ligating pre-adenylated linker to the 3’-OH of RNA using RNA ligase2 ...
-
bioRxiv - Genomics 2023Quote: ... followed by 23.5 μl of ligation mix (3 μl 1x T4 ligase buffer (NEB, B0202S), 0.15 μl 50 mg/ml BSA (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: Equal number (3×106) of cells were harvested in ice-cold nuclear extraction buffer (NEB) (400 μl ...
-
bioRxiv - Microbiology 2023Quote: ... The vigR 3’ UTR sequence was amplified from JKD6009 using Phusion Hot Start Polymerase (NEB) with primers incorporating the MS2 aptamer sequence (fused to 5’ end of vigR 3’ UTR ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified fragments were dephosphorylated at their 3′ ends with T4 polynucleotide kinase (New England Biolabs) at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q ...
-
bioRxiv - Microbiology 2023Quote: ... The 3 fragments were ligated using the Gibson Assembly® Cloning Kit (New England Biolabs). The created pEXG2::ΔfahA and pEXG2::ΔpanC were transformed into E ...
-
bioRxiv - Microbiology 2024Quote: ... the pUC19-PRha-YFP-3×FLAG plasmid was inverse amplified by PCR (Q5 polymerase, NEB), omitting the yfp gene ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3×HA-DHFR cassette was amplified from the resulting vector by Q5 polymerase (NEB) using primers containing a 50 nt overlap homologous to the either upstream or downstream regions of the TGRH88_003980_t1 stop codon (primers “flank fwd Tgurpl11m tagging” and “flank rev Tgurpl11m tagging” in table S9 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Following one-hour outgrowth in 1 mL of SOC medium (NEB #B9020S) at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... 500 μl of lysed cells were transferred to a tube containing 4.5 ml of digestion mix (1X NEB 3 buffer, 1% triton X-100) and 100 μl of the lysed cells were transferred to a tube containing 0.9 ml of digestion mix ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 and 6 and then assembled into pASW vector by NEBuilder Hifi DNA Assembly kit (NEB).
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... or enzymatic methylation conversion (Enzymatic Methyl-seq Conversion Module, NEB Product #E7125L) to convert unmethylated cytosine to uracil ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were constructed by using the NEBNext Enzymatic Methyl-seq Kit (NEB), following manufacturer’s guidance ...
-
bioRxiv - Genomics 2020Quote: ... with 2 μl (5 U/μl) of Klenow fragment exo- (NEB) in a final volume of 55 μl by incubation at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM HDVLig (pre-adenylated using a 5’ adenylation kit (NEB)) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl Hot Start High-Fidelity 2× Master Mix (M0494S; NEB) and nuclease-free water to fill up to 10 μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µl Klenow enzyme (5 units/µl, New England Biolabs, M0210S), and 3 µl 10 mM dNTP (KAPA HiFi Kits from Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... D-loops were deproteinized by adding 2 μL of 5% lithium dodecyl sulfate and 1 μL of 20 mg/mL proteinase K (New England Biolabs), and incubating the mixture at 37°C for 15 min ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were washed two times in barcode wash buffer (+5 μM each of quenching oligo 1 & 2) and then resuspended in ice cold 1x ThermoPol reaction buffer (NEB) cells were passed through a 40μm strainer and counted ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 µl were used for amplification with Taq 2X Master Mix (New England Biolabs, Ipswitch, USA) using a 20-cycles PCR protocol ...
-
bioRxiv - Physiology 2021Quote: ... RNA 3’ end dephosphorylation reaction consisted of T4 PNK (20 U/10 μL sample, NEB M0201S), SuperaseIn in 1X T4 PNK buffer without ATP for 60 min at 37 °C ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA from A549 cells (3 µg in 30 µl) was treated with RppH (NEB M0356) at 30 °C for 1 hr and purified by spin column ...
-
bioRxiv - Genomics 2020Quote: ... Fragmented RNAs were then dephosphorylated at their 3’ end using PNK (New England Biolabs, Cat: M0201) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Biochemistry 2021Quote: ... Table 3) region of clpP1 was amplified by PCR (GC buffer, Phusion polymerase, New England Biolabs) using isolated L ...
-
bioRxiv - Biochemistry 2020Quote: ... Desalted peptides were dissolved at a concentration of 3 µg/µL in 1x CutSmart buffer (NEB, 50 mM potassium acetate ...
-
bioRxiv - Biophysics 2021Quote: Purified plasmids were digested at the 3’ end of the insert sequence with EcoRI-HF (NEB) to linearize the template with a 5’ overhang for in vitro transcription ...
-
bioRxiv - Genomics 2022Quote: ... 3 ug of input DNA was dephosphorylated with Quick CIP (New England Biolabs, cat no M0508). Following enzyme inactivation with alkaline phosphatase ...
-
bioRxiv - Bioengineering 2022Quote: ... NU-1707L) was added to the probes’ 3’ ends with Terminal Transferase (New England Biolabs, M0315L), which adds a single azido-dATP molecule ...
-
bioRxiv - Developmental Biology 2022Quote: ... Ribosome footprints were generated by incubating the lysate with 3 U/µg of micrococcal nuclease (NEB) for 40 min at 25° C ...
-
bioRxiv - Developmental Biology 2020Quote: ... The bcd-3’UTR was PCR amplified using Q5 high-fidelity polymerase (New England Biolabs, M0491S) from genomic DNA using the primers 5’-GAGTCATCA-TCATCAGTTTCGTCAAAAGTAACCTGGATGAGAGGCGTGTTAGAG-3’ and 5’-CTGGGTCG-GCGCGCCCACCCTTGTCTAGGTAGTTAGTCACAATTTACCCGAGTAGAGTAG-3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... rinsed with PBS and incubated in PBS containing 3% molecular biology grade BSA (New England Biolabs) and 0.05% Tween-20 for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... Then the piggy-bac vector pPBhCMV1-miR(BsgI)-pA-3 was digested with BsgI (#R05559S, NEB) and the digested vector excised from a DNA agarose gel and the DNA purified ...
-
bioRxiv - Microbiology 2019Quote: ... for each sample 3 μg of DNase-digested RNA was treated with T4 Polynucleotide Kinase (NEB) for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... the 3’ ends of RNA fragments were dephosphorylated with T4 polynucleotide kinase (New England BioLabs #M0201S). A preadenylated DNA adaptor sequence was ligated to the 3’-hydroxyl ends of the RNA fragments using T4 RNA Ligase (T4 RNA Ligase 2 ...
-
bioRxiv - Genomics 2021Quote: ... dATP was added to the 3’ ends by adding 9μL of A-tailing mix (5μL NEB buffer 2.1 ...
-
bioRxiv - Genomics 2021Quote: dATP was added to the 3’ ends by adding 9μL of A-tailing mix (5μL NEB buffer 2.1 ...
-
bioRxiv - Genomics 2021Quote: ... followed by an overnight incubation at 16°C with 3 µL T4 DNA ligase (NEB, M0202). Samples were purified with phenol-chloroform and used as 3C templates for Taqman-qPCR ...
-
bioRxiv - Biochemistry 2021Quote: ... Concentrated medium was collected from the filters and 3 μl of PNGase F (New England Biolabs) was added to each sample then incubated at 37 °C for 24 h ...
-
bioRxiv - Biochemistry 2021Quote: ... media was replaced with media containing 3 µM SNAP-Cell block (New England BioLabs cat. # S9106S) and cells maintained at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Table 3) region of clpP1 was amplified by PCR (GC buffer, Phusion polymerase, New England Biolabs) using isolated L ...