Labshake search
Citations for New England Biolabs :
1151 - 1200 of 7667 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Genomics 2021Quote: ... 100 ng of genomic DNA were digested for 6h at 65°C with 20 U TaqI (New England Biolabs) and 6h hours at 37°C with 20 U of MspI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µl murine RNase inhibitor per sample and 3 µl were added to each sample together with 2 µl truncated T4 polynucleotide kinase (#M0201, NEB; Frankfurt/Main, Germany). Samples were incubated for 2 h at 37°C and the enzyme was deactivated after the reaction by 10 min incubation at 75°C ...
-
bioRxiv - Genomics 2022Quote: ... and for the synthesis of the second strand of cDNA was used the Klenow fragment 3’-5’ exo (New England Biolabs Inc., Ipswich, MA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 3 uL of Taq polymerase (New England BioLabs, Ipswich, MA, USA), 1 uM of 50 mM MnCl2 ...
-
bioRxiv - Cell Biology 2020Quote: H4-SNAP histones were labelled with 3 μM TMR fluorophore (NEB) for 30 min in complete medium ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 μL of 20 mg/mL Proteinase K (NEB EO0491) was added to each sample ...
-
bioRxiv - Microbiology 2020Quote: ... and 3’-end dephosphorylated by 10 U T4-PNK (M0201S, NEB) in the presence of 20 U RNase inhibitor (M0314L ...
-
bioRxiv - Microbiology 2020Quote: ... For 3’ adaptor ligation the NEBNext Small RNA Kit (E7560S, NEB) was used ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3 μl of USER enzyme (New England Biolabs; cat. no. M5505) were mixed with 16 μl of adapter-ligated DNA ...
-
bioRxiv - Bioengineering 2019Quote: Single stranded plasmid master mix (3x): 3 U/µL Nb.BbvCI (NEB), 36 U/µL Exonuclease III (ExoIII ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 μl (0.5 μl per sample volume) of RNase If (NEB) was added and the sample was incubated at 37 °C for 15 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... mixed with 3 µL 10% SDS and 1.8U Proteinase K (NEB), and incubated for 1 hour at 50°C ...
-
bioRxiv - Molecular Biology 2022Quote: 3’-end 32P-labelled gapped DNA was generated using TdT (NEB) and [α-32P]dATP (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 μl of USER enzyme (New England Biolabs; cat. no. M5505) were mixed with 16 μl of adapter-ligated DNA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 2.5 μl of T4 DNA polymerase (3 U/μl NEB M0203), 2.5 μl of T4 PNK (10 U/μl ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.5 μl T4 DNA Polymerase (NEB, cat#M0203S, 3 U/μl) and 0.1 μl Taq DNA Polymerase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL NEBNext End Prep Enzyme mix (New England Biolabs, USA), 2.5 µg fragmented DNA and adjusted to 50 µL with nuclease free water (Qiagen ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... ligated to a 3’ adaptor using T4 RNA Ligase I (NEB), and purified using SDS-polyacrylamide gel electrophoresis (SDS-PAGE ...
-
bioRxiv - Genomics 2021Quote: ... mixed with 3 μL 10% SDS and 1.8U Proteinase K (NEB), and incubated for 1 hour at 50°C ...
-
bioRxiv - Biophysics 2020Quote: ... GRN-3 was expressed in SHuffle™ cells (New England Biolabs), while GRN-5 was expressed in Origami 2 DE3 (Invitrogen ...
-
bioRxiv - Biophysics 2020Quote: ... mixed with 3 μL 4x LDS loading dye (New England Biolabs) and loaded onto 4-12% NuPAGE Bis-Tris gels (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... in NEB next Quick ligation buffer (3 μl, New England Biolabs) in the presence of 1 μl RNA CS (Oxford Nanopore Technologies ...
-
bioRxiv - Genetics 2022Quote: ... and a 3’ loxP site in a HiFi Assembly reaction (NEB) with pBS-ISceI to give pBSIce-gata2aKI (Supplementary File 1).To construct a foxc1a targeting vector ...
-
bioRxiv - Microbiology 2022Quote: ... followed by 3′ adaptor ligation using T4 ligase (New England Biolabs). The ligated products were used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... All samples were mixed with 3 μl Proteinase K (NEB P8107S) and incubated for 1 hour at 50°C ...
-
bioRxiv - Microbiology 2022Quote: ... The 3’ adenine (A) overhangs were then added by Taq (NEB) PCR and cloned into the TOPO-TA plasmid (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2022Quote: ... 3 mM CaCl2) and was subjected to mild MNase (NEB, M0247S) treatment (20 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... digests were eluted in 1X NEBuffer #3 (B7003S, New England Biolabs) and undigested gDNA was eluted in TE ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and ligated species specific 3’ UTR with T4 DNA ligase (NEB). Each of the full length chimeric nos rescue fragments were cloned into pattB vectors using NotI (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 25 pmol of SSAs were folded in 1x NEBuffer 3 (NEB) by heating at 95°C for 5 min followed by slow cooling to 25°C ...
-
bioRxiv - Genomics 2023Quote: ... was digested for 3 hours with PvuII-HF (NEB cat #R3151S) or PstI (NEB cat #R0140T ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Purified PCR products were 3′A-tailed using Taq polymerase (NEB) and cloned into TOPO TA-cloning vector (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... 3 μL of T4 RNA ligase buffer (NEB, cat. no: M0204S), 1 μL of 10 mM ATP (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3′-A overhang was added with Klenow fragment (NEB; M0212) and dATP ...
-
bioRxiv - Genetics 2024Quote: ... and 3 units of Taq DNA Polymerase (New England Biolabs, Inc.) under the following reaction conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The fragmented RNA was 3’-end repaired using T4 PNK (NEB) and ligated to RNA adapter (5’-/5rApp/AGATCGGAAGAGCGTCGTG/3SpC3/-3’ ...
-
bioRxiv - Biophysics 2021Quote: ... PfK5ΔL6-MD-SNAP was biotinylated or fluorescently labelled by overnight incubation at 4°C with SNAP-Biotin® or SNAP-Surface® Alex Fluor® 647 (New England BioLabs) with at least a 3:1 molar excess of these labels to PfK5ΔL6-MD-SNAP ...
-
bioRxiv - Cancer Biology 2019Quote: ... sequences are listed in Supplementary Table 4) and cloned into pGL3-TK-5UTR-BsmBI-Luciferase using BsmBI (New England BioLabs; Whitby, Ontario, Canada). The “Snail 417” UTR insert was generated by PCR using the forward primer TATCGTCTCAACACCGAGCGACCCTGCATAAGCTTGGCGCTGAGCCGGTGGGCG and the reverse primer ATACGTCTCTCTTCCATAGTGGTCGAGGCACTGGGGTCG ...
-
bioRxiv - Biochemistry 2021Quote: ... The fragment was ligated into the pLSV101 vector (3:1 molar ratio) with T4 DNA ligase (New England Biolabs) (16 °C overnight) ...
-
bioRxiv - Molecular Biology 2021Quote: ... before incubation during 6 min in 50μl of PNK reaction mix (1x PNKT, 1 mM ATP and 0.05 U/ml T4 PNK 3′phosphatase minus (NEB) in a thermomixer at 37°C and 1400rpm ...
-
bioRxiv - Microbiology 2021Quote: ... the THN gene was ligated to pICH41021 in a 3:1 molar ratio using T4 Ligase (New England Biolabs) at 4°C overnight and transformed by heat shock into chemically competent E ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ligation of the 3’ adapter was done using the T4 RNA Ligase 1 (New England Biolabs, Ipswich, MA, M0204L). Ligation of 5’ adaptor required (i ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ terminus of total RNAs were ligated with the irCLIP adaptor by T4 RNA Ligase 1 (NEB, M0437M). After ligation ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 20 minutes at 80 °C followed by adding annealed inserts to vector DNA (0.020 pmol) at a 3:1 molar ratio with T4 DNA ligase (400 units; M0202S, New England Biolabs), T4 DNA ligase buffer and nuclease free water to a final volume of 20 μL for 30 minutes at room temperature and then 65 °C for 10 minutes.
-
bioRxiv - Systems Biology 2020Quote: 3’ ends of the RNA fragments were dephosphorylated using 0.5 U μl−1 calf intestinal phosphatase (New England Biolabs) for 10 min at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... aurantiaca DW4/3–1 genomic DNA and cut by restriction enzymes NdeI and HindIII (New England Biolabs, Beverly, USA), and ligated into the corresponding sites of the expression vector pET28c(+ ...
-
bioRxiv - Developmental Biology 2023Quote: ... mixed in a ratio 1:3 (insert:backbone plasmid) and ligated with T4 ligase according to manufacturer’s instructions (Quick Ligation kit, NEB M2200). The ligation reaction was transformed into competent TOP-10 bacteria and plated on agarose plates with Ampicillin ...
-
bioRxiv - Biochemistry 2024Quote: ... 0,5 μM fluorescently tagged 3’ adapter (MultiplexDX) were ligated with T4 Rnl2(1–249)K227Q (M0351, New England Biolabs) overnight at 4°C and washed three times with PNK/ligation buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.5 μM fluorescently tagged 3’ adapter (MultiplexDX) were ligated with T4 Rnl2(1–249)K227Q (M0351, New England Biolabs) overnight at 4°C and washed three times with PNK/ligation buffer ...