Labshake search
Citations for New England Biolabs :
1351 - 1400 of 7694 citations for 2R 5S 5 4 amino 5 fluoro 2 oxopyrimidin 1 2H yl 1 3 oxathiolan 2 yl methyl butyrate WXC04778 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and use of a specific barcode from the NEBNext® Multiplex Oligos for Illumina® Index Primers Set 1 or 2 (New England Biolabs). Quality and quantity of total RNA ...
-
bioRxiv - Immunology 2021Quote: ... Add 30 μl PCR master mix (2.5 μl Illumina dual indexes primer 1, 2.5 μl Illumina dual index primer 2, 25 μl NEB Q5 HotStart Master Mix) to the 20 μl beads bound with samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37° C for 2 hrs from 1 µg purified dsDNAs using a T7 high yield RNA synthesis kit (NEB, Cat # E2040S) in a total volume of 20 µL ...
-
bioRxiv - Biochemistry 2024Quote: ... coli (Suppl. Table 1) were cloned into a pBAD24 with ampicillin resistance using the USER cloning method (New England Biolabs, Table 2). All sequences were cloned including a 10x histidine tag located in the N-terminus for BtuG1-3 and the C-terminus for BtuG2 and all its mutants ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Molecular Biology 2020Quote: ... tRF-5s, itRFs were end-labeled with 32P-ATP (Board of Radiation and Isotope Technology, India) using polynucleotide kinase (NEB), purified through MicroSpin G-25 Columns (GE Healthcare) ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA coding region corresponding to RDGBPITPd-FFAT (amino acids 1-472) was subcloned into pUAST-attB by using the restriction enzymes NotI and XbaI (NEB). Similarly ...
-
bioRxiv - Microbiology 2022Quote: ... and a subpart of it encoding specifically the PAS domain (amino acids 1-138) the corresponding coding sequence was amplified by PCR using the Phusion DNA polymerase (New England Biolabs) and cloned between the NdeI and BamHI sites ...
-
bioRxiv - Cell Biology 2020Quote: ... A fragment of human Plexin-B1 cDNA (encoding amino acids 1-535) was cloned into the pcDNA5 vector using HindIII (R0104S, NEB) and XhoI (R0146S ...
-
bioRxiv - Molecular Biology 2024Quote: ... The signal peptide was removed (amino acids 1-35) by mutagenesis using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Plant Biology 2021Quote: Whole-genome enzymatic methyl-seq libraries were prepared using the NEBNext® Enzymatic Methyl-seq kit (New England BioLabs®, Inc.) following the protocol for standard insert libraries (370-420 base pairs) ...
-
bioRxiv - Molecular Biology 2024Quote: ... After addition of 200 µl nuclease elution mix (NEB nuclease P1 buffer 1 x, MgCl2 5 mM, 0.5 µl NEB nuclease P1, 0.5 µg benzonase) samples were incubated over night at 37 °C ...
-
bioRxiv - Genetics 2023Quote: ... We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles, Tm 62 °C). We finally added dual indexing primers using the i5 and i7 system from Illumina (NEB Q5 for 20 cycles ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.5-5 μg of column purified DamID material (from above) was end-repaired using the NEBNext End Repair Module (NEB E6050S) following manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2020Quote: ... pCS2+MT-hoxb4a was linearized with NotI and transcribed with SP6 RNA polymerase in the presence of a G(5′)ppp(5′)G RNA cap structure analog (New England BioLabs Inc.). 25 pg of hoxb4a mRNA was injected into one-cell-stage embryos.
-
bioRxiv - Systems Biology 2021Quote: ... PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6) for 5 cycles at an annealing temperature of 66C followed by 5 cycles with no annealing step (NEB Q5) and then purified with the Monarch PCR kit.
-
bioRxiv - Systems Biology 2021Quote: ... P1 indexing barcodes were added using forward primers P1_inner_A through P1_inner_D and reverse primer P1_inner_nested_rev (Supplementary file 6) for 5 cycles at an annealing temperature of 55C followed by 5 cycles with no annealing step (NEB Q5). PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6 ...
-
bioRxiv - Microbiology 2020Quote: ... was PCR amplified with forward primer (5’CGCGGATCCATGGATTTGTTTATGAGAATCTT3’) and reverse primer (5’ AAGGAAAAAAGCGGCCGCCAAAGGCACGCTAGTAGTC3’) by using Phusion High-Fidelity DNA Polymerase (New England Biolabs, M0530L) according to the manufacturer’s protocol and inserted into pcDNA5.1/FRT/TO vector (a kind gift from professor Torben Heick Jensen ...
-
bioRxiv - Genomics 2024Quote: ... We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (FP-5’AGAACGGCAACTCCAATGGC3’ and RP-5’GCCAGTCTCCTTGTCAATGA3’) and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles) ...
-
bioRxiv - Genomics 2024Quote: ... by including a tevopreQ1 motif,40 we first inserted a DNA duplex annealed from DNA oligos (5′-CGCGCCCGTCTCACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTTTC, 5′-TCGAGAAAAAAATTCTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGTGAGACGGG) into pJY127 digested with AscI (NEB R0558S) and XhoI ...
-
bioRxiv - Microbiology 2024Quote: ... The PS oligonucleotide (5’-CGCGGGCCTCTACAACCGGCACCGTG) was synthesized by IDT and 5’-labeled with [γ-32P]ATP and T4 polynucleotide kinase (NEB) to generate the [32P]PS probe ...
-
bioRxiv - Biophysics 2022Quote: ... A low-pressure chromatography column connected to a peristaltic pump (5 mL/min flow rate) was prepared with 5 mL amylose resin (NEB #E8021S), followed by equilibration with 50 mL Amylose A Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... pUA_minusFP_R: 5’ggatccatcgaggtgaagacg) and circularizing the product with a bridging oligonucleotide (5’cgtcttcacctcgatggatccatgtccagacctgcaggcatg) using the NEBuilder® HiFi DNA Assembly (NEB) kit ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA bound to the beads was made ss by λ exonuclease digestion of the strand with 5’ phosphate (5 U/mg DNA, NEB). The reaction was carried out at 370 C for 1 h ...
-
bioRxiv - Microbiology 2024Quote: ... and dominant negative RabD2T91N (RabD2TN) primers (forward primer 5’TGTTGGTAAAAACTGTTGTATGAATAGATATGTTAG3’ reverse primer 5’GAAGACTCTCCTACCATAATAAC3’) using Q5 Site-directed mutagenesis kit (E0554S New England Biolabs, USA) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and 4 µl of hot PNK mix (0.2 µl PNK [New England Biolabs], 0.4 µl 32P-γ-ATP, 0.4 µl 10x PNK buffer [New England Biolabs], 3 µl H2O) was added and incubated for 5 min at 37°C in a thermomixer at 1,100 rpm ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.5 mg of pNL003 plasmid (38) was linearized by incubation at 37 °C for 2-4 h in the presence of EcoRV (NEB R0195S). Transcription reactions (10 mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 2 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Standard Illumina adapters were ligated using 60 cycles of digestion at 37 °C (2 minutes) and ligation at 16 °C (4 minutes) with 400 U of T4 ligase (New England Biolabs, USA), followed by heat-inactivation at 65 °C (10 minutes) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 4 µg of each lysate in 2X Laemmli buffer containing DTT/BPB was combined with GlycoBuffer 2 (1X final; NEB, P0704S) and NP-40 (1% final ...
-
bioRxiv - Immunology 2021Quote: ... the samples were added to 2 μL of second-strand synthesis mix containing 2.25× NEB buffer 2 (NEB), 0.625mM each dNTP Mixture (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The purified products were subjected to dA tailing with 2 μL of 10X NEBuffer 2 (New England BioLabs), 0.1 μL of 100 mM dATP ...
-
bioRxiv - Biochemistry 2024Quote: ... the reaction described above included another 2 µL of mRNA cap 2′-O-methyltransferase (50 U/µL, NEB). The capping reaction was incubated at 37°C for 4 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µl exonuclease T with 10 µl buffer 4 (NEB) was used in the enzymatic reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein Phosphatase Inhibitor 2 (New England Biolabs) and Trichostatin A HDAC inhibitor (TSA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl 10 mM ATP (NEB, 0756), 1 µl 100 mM DTT (Cell Signaling Technology Europe ...
-
bioRxiv - Cell Biology 2020Quote: ... in 1x glycobuffer 2 (New England Biolabs), and 10% NP-40 (New England Biolabs ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μL T4 PNK (NEB, M0201L) were added to the sample in respective order ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 µl of 20 µM SpCas9 (NEB, Cat ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3.13 μL BSA 2 mg/mL (NEB), 12.5 μL FastDigest NotI (ThermoFisher) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3.13 μL BSA 2 mg/mL (NEB), 12.5 μL FastDigest NotI (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10ng of 2-log ladder (NEB N3200L) was loaded instead of 100ng ...
-
bioRxiv - Genomics 2020Quote: ... in 1X Buffer 2 (New England Biolabs) at 37°C for 1 hr ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl T4 ligase (New England Biolabs), 2 μl SrfI (New England Biolabs) ...
-
bioRxiv - Genomics 2021Quote: ... 25 µL 2× Q5 master mix (NEB); 1 µL 10 µM TruSeq PCR handle primer (IDT) ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 μl fragmentase (New England Biolabs) and brought up to 20 μl in nuclease free water and incubated at 37°C for 20 minutes before stopping with 5 μl of 0.5M EDTA ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mM ribonucleoside vanadyl complex (NEB S1402S), 100 units/mL SUPERase In (Thermo Fisher AM2694) ...
-
bioRxiv - Bioengineering 2020Quote: ... 2 U/µlL murine RNase inhibitor (NEB), 1.5 U/µl NextGen T7 RNA polymerase (Lucigen) ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2% BSA (B9000S, New England Biolabs) for 1 hour at room temperature ...