Labshake search
Citations for New England Biolabs :
1251 - 1300 of 7694 citations for 2R 5S 5 4 amino 5 fluoro 2 oxopyrimidin 1 2H yl 1 3 oxathiolan 2 yl methyl butyrate WXC04778 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... followed by the addition of 5 μl of UDG reaction solution (New England Biolabs, 0.02 U μl−1 UDG in 1X UDG buffer) and an additional 30 min incubation at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction was slowly cooled down to room temperature with a Δ -1°C / second gradient and 0.5 μl of each RNase H (NEB, 5 U/μl), RNase T1 (ThermoFisher Scientific ...
-
bioRxiv - Physiology 2022Quote: ... The single stranded cDNA was ligated with a partial Illumina 5’ adaptor (HZG885:/5phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTddC) using T4 RNA ligase 1 (New England Biolabs, Ipswich, MA, US) and incubated overnight at 22 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The lenti-sgRNA puro vector was digested with EcoRI for 2h at 37°C followed by digestion with BsmBI for 2 hours at 55°C and treatment with 4 μl of rSAP (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Non-encapsidated nucleic acids were removed by mixing 900 μL of each sample with 100 μL 10x DNase buffer and supplemented with 2 μL (4 U) of DNase I (NEB) and 1 U of RNase ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Transformations for integration onto p1 were performed as described previously:15 2–4 µg of plasmid DNA with ScaI restriction sites adjacent to integration flanks was cut with ScaI-HF (NEB) and transformed into yeast harboring the wt p1 and p2 plasmids ...
-
bioRxiv - Genomics 2021Quote: ... Purified RNA was fragmented 2-4 minutes (depending on the RNA Integrity Number) using NebNext Magnesium RNA Fragmentation Module (New England Biolabs) and once again purified with the RCC kit (Zymo Research ...
-
bioRxiv - Immunology 2022Quote: ... Sample index PCR: 2 µl tagging PCR product was mixed with 18 µl PCR mix (4 µl 5x phusion HF buffer (NEB); 0.4 µl Phusion DNA Polymerase (NEB) ...
-
bioRxiv - Genetics 2024Quote: ... The 24 μl of dA-tailed DNA and 2 μl of ligation adapter were ligated using 4 μl of Quick T4 DNA Ligase (New England Biolabs) in 40 μl of reaction volume ...
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...
-
bioRxiv - Biochemistry 2022Quote: ... Linearised plasmid was mixed with 2-3-fold excess of the three insert fragments followed by addition of Gibson Assembly® Master Mix (New England Biolabs) and incubation at 50°C for 60 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3′ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L). Linker-ligated footprints were reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 0.5-1.0 μg of genomic DNA for each sample was heated at 65°C for 2-3 hours prior to digestion with PstI (New England Biolabs, UK). This enzyme has a 6 bp recognition site and leaves a 4 bp overhang ...
-
bioRxiv - Molecular Biology 2021Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L). Linker-ligated footprints were reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA ligase 2 truncated KQ (NEB, M0373L). Linker-ligated RNA was reverse transcribed with Protoscript II (NEB ...
-
bioRxiv - Genomics 2023Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L).
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was stopped by incubating at 65°C for 5 min followed by addition of 5 mM MgCl2 and 0.5 units of Shrimp Alkaline Phosphatase (rSAP, NEB M0371S). The phosphatase reaction was incubated at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... RJ-167-mer and RJ-5’Tail-167mer were radiolabeled with 32P at the 5′-end using T4 Polynucleotide Kinase (NEB). To generate the 3′ Tail and dsDNA DNA substrates ...
-
bioRxiv - Cell Biology 2022Quote: ... The 229E Spike cDNA was amplified by PCR with the forward primer: 5’-TTTTTTGCGGCTAGCATGTTCGTGCTGCTGG and the reverse primer: 5’-TTTTTTGCGCTCGAGTCACGCCGGCGCCACCTGGCTGGTTTCGGTCTGGATGTGGATC TTTTCCA using Phusion polymerase (New England Biolabs) according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... forward and reverse primer for GFP (forward 5’TCGACAGTCAGCCGCATCT3’ and reverse primer 5’CCGTTGACTCCGACCTTCA3’) respectively using 1μl taq polymerase (NEB, USA). The PCR amplification was performed as per the following cycle ...
-
bioRxiv - Neuroscience 2022Quote: ... and oligos annealed with adapters to the sense 5’ - CACC and antisense 5’-AAAC were ligated using Quick Ligase Kit (New England Biolabs). Ligated product was transformed into stabl3 competent E ...
-
bioRxiv - Systems Biology 2020Quote: ... and at least 1 μg but no more than 5 μg DNA was put into an end-resection reaction (5 U T4 DNA Polymerase, NEB) to remove biotin from unligated ends ...
-
bioRxiv - Microbiology 2021Quote: ... Linearized DNA was purified by phenol/chloroform extraction and RNA was in vitro transcribed in the presence of G(5’)ppp(5’)G RNA Cap structure analog using SP6 polymerase (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... The F1 progeny of the injected animals were selected for the roller phenotype and screened by PCR (forward primer 5’ TTGGAAGTGTTCGGTTACAAAA; reverse primer 5’ AAACTAAAATTGGCACGAAACG; IDT) and NcoI restriction digestion (New England Biolabs). Non-roller ...
-
bioRxiv - Genomics 2022Quote: Add 5 μl of dNTP mix (10 mM each) and 5 μl of DNA polymerase I Klenow fragment (NEB, M0210) to the reaction system ...
-
bioRxiv - Synthetic Biology 2022Quote: ... NNN spacer to increase library diversity during sequencing (preadenylated oligos were prepared by 5’ DNA adenylation kit (E2610L) using thermostable 5’ App DNA/RNA ligase (M0319L, both from New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ triphosphates on the synthesis products were converted into 5’ monophosphates: samples were treated with recombinant shrimp alkaline phosphatase (NEB) (10 µl reaction in 1× NEB buffer 2.1 ...
-
bioRxiv - Microbiology 2023Quote: ... and ligating 5 µL of 5 µM spacers (annealed oligos) with 80ng of BsaI-digested backbone using the T4 ligase (NEB). We chose spacer sequences based on protospacer position and their association with a 5’-AAG-3’ motif and annealed them from two oligonucleotides with the according restriction site overhangs (95 °C for 5 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Molecular Biology 2023Quote: The nascent RNAs bound to Streptavidin Dynabeads were 5’ de-capped by diluting in RNA 5’ Pyrophosphohydrolase (RppH) mix (NEB) and incubation at 37 °C for 45 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... BSP1 was amplified from genomic DNA with primers 5’-ctggaagttctgttccaggggcccatgacaaaatatgagcgtgaccctg and 5’-ccccagaacatcaggttaatggcgttacacgcgtgttggaagttttcttc while pCoofy3 was linearized with primers 5’-cgccattaacctgatgttctgggg and 5’-gggcccctggaacagaacttccag using Q5 High-Fidelity 2X Mastermix (New England Biolabs). After DNA fragments were purified from agarose gel ...
-
bioRxiv - Microbiology 2023Quote: ... Second DNA adapters (containing 5 [N5] or 10 [N10] random bases at the 5′-end) were ligated to the 5′-end of the cDNA (T4 RNA Ligase, NEB). The DNA was amplified by PCR and purified with PippinPrep system (Sage Science ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting cDNA was then amplified by PCR using the PBAD 5’- RACE universal primer (5’ACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCAT3’) and the S17-specific primer IgBP3151-171R (5’CTTGCGATCTCGGGCTAAATCCACCA3’) in the presence of Q5 DNA polymerase (NEB) and dNTPs ...
-
bioRxiv - Plant Biology 2021Quote: ... a non-adenylated 3’ adapter was ordered for chemical synthesis from IDT™ and adenylated with the 5’ DNA Adenylation Kit (New England Biolabs® Inc.) (see Supplemental Table 4 for primers and adapters used) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5 µl NEB CutSmart buffer (NEB, B7204) in a reaction volume of 50 µl for 3 hrs at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 5 units of LongAmp taq DNA polymerase (NEB) and 50 ng of DNA sample extracted from infected cells in a 50 ⍰l final reaction volume ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 10 U/uL of 5’ deadenylase (NEB M0331S), 10 U/uL Rec J exonuclease (Epicentre RJ411250) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and MseI to generate 5’ TA overhangs (NEB). After dephosphorylation ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% (v/v) Ribonucleoside Vanadyl Complex (NEB)) at 4°C for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% (v/v) Ribonucleoside Vanadyl Complex (NEB)) and homogenized centrifuged at 15.000 g at 4°C.
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μl 10X CutSmart Buffer (New England Biolabs), 10 μl 10mM ATP (New England Biolabs) ...
-
bioRxiv - Immunology 2021Quote: ... Uracil-DNA glycosylase (NEB, #M0280S, 5 U/ul) was added and the reaction was incubated for 1 h at 37°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 units of Klenow DNA polymerase (NEB) to 80 µL of repaired mononucleosomal DNA to a final reaction volume of 120 µL ...
-
bioRxiv - Neuroscience 2020Quote: ... or α2-3,6,8 Neuraminidase (5 U/ml; NEB) for 2 hours before motoneurons were added (Supplementary Figure 7).
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 μl 5’Ligation Reaction Buffer (NEB-kit) and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μM dNTP (New England Biolabs, # N0446S) in 17.5 μl 1x CutSmart buffer (New England Biolabs ...
-
bioRxiv - Biophysics 2021Quote: ... and 5 mg/mL purified BSA (NEB, G9001S), to prevent non-specific interaction of Cy5-eIF4E with the chip surface ...
-
bioRxiv - Molecular Biology 2022Quote: ... and processed with 5 units of T7EI (NEB) for 1 hour at 37 °C before resolved on 10% TBE PAGE gels (BioRad ...
-
bioRxiv - Cell Biology 2022Quote: ... add 5 μL Proteinase K (New England BioLabs), scrape cells from 24-well ...
-
bioRxiv - Molecular Biology 2022Quote: ... with 5 μl T4 Ligase Buffer (NEB, B0202), 400 units T4 Ligase (NEB ...