Labshake search
Citations for New England Biolabs :
1301 - 1350 of 6948 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA inserts were PCR-amplified using NEBNext High Fidelity PCR Master Mix (NEB, M0541). The resulting PCR amplicons were purified using Ampure XP Beads and sequenced using the HiSeq 2500 system (Illumina ...
-
bioRxiv - Bioengineering 2022Quote: ... PCR products were column-purified (Monarch PCR & DNA Clean-up Kit, New England BioLabs) and submitted for Sanger sequencing (Genewiz ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA samples were PCR-amplified using standard Illumina adaptors and Q5 PCR mix (NEB) with 10-13 cycles (SMInputs ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were generated by two-step PCR utilizing Q5 polymerase (New England Biolabs) with an annealing temperature of 72°C and a 2-minute extension time ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were column-purified (Monarch PCR & DNA Clean-up Kit, New England BioLabs) and submitted for Sanger sequencing (Genewiz ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reactions were performed utilizing the Phusion High-Fidelity PCR Master Mix (NEB, M0531L) to prevent any mutations ...
-
bioRxiv - Genomics 2023Quote: ... DNA was amplified by PCR with NEBNext HiFi 2x PCR Master Mix (NEB M0541S) and library was purified by 1.3X SPRI purification (Omega Bio-Tek ...
-
bioRxiv - Genetics 2023Quote: ... PCR reactions were performed with Phusion High-Fidelity PCR Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... The VHH specific sequence was amplified using PCR (Phusion High Fidelity PCR kit, NEB) and correct overhangs were incorporated ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR was performed using Phusion High-Fidelity PCR Master Mix (New English Biolabs, England). PCR products were quantified using 2% agarose gel electrophoresis ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PCR reactions contained 1X Phusion High-Fidelity PCR Master Mix (New England BioLabs Inc.), 0.5 μM primers (forward ...
-
bioRxiv - Microbiology 2023Quote: ... the PCR reaction was purified using the Monarch PCR Cleanup Kit (New England Biolabs). DNA was sent for Sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: PCR products were routinely purified using Monarch® PCR & DNA clean-up kit (NEB), or E.Z.N.A.® Cycle Pure Kit (Omega Bio-Tek ...
-
bioRxiv - Genomics 2023Quote: ... PCR was performed with the Phusion High-Fidelity PCR kit (E0553L, New England BioLabs) with the following cycling conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR was performed using NEBNext® High-Fidelity 2X PCR Master Mix (NEB; M0541S). The purified PCR products were separated by a 4-20% TBE gel (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... and PCR amplified and barcoded with NEBNext High-Fidelity PCR Mix (New England Biolabs) and unique dual indexes (Illumina) ...
-
bioRxiv - Systems Biology 2024Quote: ... PCR products were spin-purified using the Monarch PCR & DNA Cleanup Kit (NEB T1030) or the DNA Clean & Concentrator-5 kit (Zymo Research ...
-
bioRxiv - Immunology 2024Quote: ... and PCR amplified with NEBNext High Fidelity 2x PCR Master Mix (New England Biolabs). Following purification with the PCR Purification Kit (QIAGEN) ...
-
bioRxiv - Cancer Biology 2024Quote: ... For PCRs we used Phusion High-Fiedlity PCR Master Mix with HF Buffer (NEB) and reactions were run as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Linearized cDNA was PCR amplified using Phusion High-Fidelity PCR Master Mix (NEB, M0531S).
-
bioRxiv - Genetics 2021Quote: ... 0.5 μM MPRA_v3_F and MPRA_v3_20I_R primers (Supplementary Table 14) and 2 ng BSA (NEB, B9000). PCR master mix was emulsified by vortexing with 220 μL Tegosoft DEC (Evonik) ...
-
bioRxiv - Cell Biology 2022Quote: ... NEBNext Multiplex Oligos for Illumina Index Primers were used for library preparation (New England Biolabs). Libraries were sequenced using an Illumina HiSeq4000 to obtain single-end 36 nt sequences at the University of Chicago Genomic Facility.
-
bioRxiv - Biochemistry 2019Quote: ... The cDNA was amplified for 6-16 cycles (primers below) with Phusion Polymerase (NEB, #E0553L) and gel-purified with ZymoClean Gel DNA Recovery Kit (Genesee Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and random primers and cDNA obtained amplified using Q5® DNA Polymerase (New England Biolabs) with gene specific oligonucleotide primers (Table 1).
-
bioRxiv - Microbiology 2021Quote: ... following manufacturer’s instructions and NEB Next Multiplex Oligos for Illumina (96 Index Primers, NEB #E6609) for multiplexing ...
-
bioRxiv - Microbiology 2020Quote: ... Specific primers were designed following the instructions of the Q5 site-directed mutagenesis kit (NEB) (primers 35-38 ...
-
bioRxiv - Biochemistry 2021Quote: ... primers were designed using CRY-WT-CLIP as the template by NEBaseChanger (New England Biolabs). The desired DNA was amplified by PCR as above ...
-
bioRxiv - Genetics 2022Quote: ... The reverse primers for this reaction were the NEBNext® Multiplex Oligos for Illumina (NEB; Supplementary information ...
-
bioRxiv - Biochemistry 2022Quote: ... 29 μl of purified modified RNA was added to 100 ng Random Primer 9 (NEB) and 0.2 mM of each dNTP ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was amplified with primers flanking each splice site by Taq polymerase (NEB, Hitchin, UK) (thermocycling parameters outlined in Table 3) ...
-
bioRxiv - Microbiology 2021Quote: ... primers MR161 and MR162 (Table 2) were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs) at 37°C for 1 h in a 4.5 μl reaction volume with 10 μM primer ...
-
bioRxiv - Genomics 2019Quote: ... followed by the addition of 0.5 µl of 250 mM Random Primer 6 (S1230S, NEB) and 1 µl Deoxynucleotide Solution Mix (N0447 ...
-
bioRxiv - Microbiology 2019Quote: ... The primers were designed using the NEBuilder for Gibson Assembly tool online (New England Biolabs) and were constructed to be used with the pNPTS138 vector (MRK Alley ...
-
bioRxiv - Genomics 2020Quote: ... the linker for reverse primers: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG using Q5 Hot Start High Fidelity DNA polymerase (NEB) and sequenced by using a NextSeq500 Instrument (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... All primers for Gibson assembly were designed using NEBuilder Assembly Tool (New England Biolabs, Inc.). For the bacA complementation vector ...
-
bioRxiv - Genomics 2019Quote: ... using an oligo(dT)24 primer and then treated with RNase H (New England Biolabs). For each time point ...
-
bioRxiv - Cancer Biology 2022Quote: ... we PCR amplified a mCMV from a plasmid using primers XhoI_attL1_mCMV_FW and SalI_mCMV_RV followed by T7 ligation (NEB) of both PCR products ...
-
bioRxiv - Plant Biology 2022Quote: ... All primers were designed with appropriate overlapping overhangs and HiFi DNA assembly master mix (NEB) was used for cloning ...
-
bioRxiv - Plant Biology 2022Quote: ... Primers for this protocol were designed using the online tool supplied by NEB (http://nebasechanger.neb.com). The second set was obtained using a high-fidelity polymerase and the following protocol (Wang and Malcolm 1999) ...
-
bioRxiv - Biophysics 2023Quote: ... Derivatives of pSB963 were altered using mutagenic primers and Q5 site-directed mutagenesis kit (NEB) to generate vectors containing CEN9 ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNA (2 µg) was first annealed with 200 ng random nonamer primers (NEB S1254S) by incubation at 70°C for 5 min ...
-
bioRxiv - Genetics 2023Quote: ... NEBNext Multiplex Oligos for Illumina Index Primers were used for library preparation (New England Biolabs). Libraries were sequenced using an Illumina HiSeq4000 to obtain single-end 50 nt sequences at the University of Chicago Genomic Facility ...
-
bioRxiv - Genetics 2023Quote: ... NEBNext Multiplex Oligos for Illumina Index Primers were used for library preparation (New England Biolabs). Libraries were sequenced using an Illumina NovaSeq6000 to obtain single-end 100 nt sequences at the University of Chicago Genomic Facility.
-
bioRxiv - Biophysics 2023Quote: ... each primer pair was annealed and consequently phosphorylated with T4-polynucleotide kinase (T4-PNK; NEB). Restriction digestion of the pLentiCRISPRv2 vector was performed using FD-Esp3I (Thermo ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pEM791 vector (32) were amplified with primers designed for Gibson Assembly (New England BioLabs). After confirming the correct sequence of the Gibson assembled plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... Dual-index primers were conjugated with NEBNext Multiplex Oligos for Illumina (Set1, New England Biolabs). We pooled all libraries ...
-
bioRxiv - Genetics 2021Quote: ... 1 μg of total Trizol-purified RNA purified was used for library preparation using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (NEB) with libraries indexed in 12 cycles PCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... Purified small RNA was subject to library prep using NEBNext Multiplex Small RNA Sample Prep Set for Illumina (NEB E7330) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... ChIP DNA was subject to library prep using NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (NEB E6240) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA was cleaved from the beads with DpnII and libraries were prepared for sequencing using the NEBNext DNA Library Prep Master Mix Set for Illumina (New England BioLabs).