Labshake search
Citations for New England Biolabs :
1301 - 1350 of 1737 citations for Natural Cytotoxicity Triggering Receptor 2 NCR2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... followed by annealing and ligation with a DNA/RNA-hybrid stem-loop adapter using T4 RNA ligase 2 (New England Biolabs), which specifically ligates the adapter to mature tRNA ...
-
bioRxiv - Pathology 2020Quote: ... DNA was visualized on 2% agarose gel and genotypes were determined based on PCR product length quantified using a DNA ladder (NEB N0556S ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each of the libraries was labeled by a specific barcode provided in NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2) (NEB) and amplified 9-13 cycles (depending on initial material amount ...
-
bioRxiv - Neuroscience 2020Quote: ... The size of libraries was selected for cDNA target fragments of 200–300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 cycles ...
-
bioRxiv - Genetics 2020Quote: ... The RNA was then diluted 1:50 and 2 mL were used to perform a one-step qPCR protocol using Luna Universal One-step qPCR kit (NEB). Two primer sets were used ...
-
bioRxiv - Microbiology 2020Quote: ... each reaction tube of 20 μl contained 10 μl of Q5 High-Fidelity 2× Master Mix (New England BioLabs Inc.), 20 pmol of forward and reverse primer ...
-
bioRxiv - Plant Biology 2021Quote: ... One μl of each 100 μM oligo was added to 500 μl 1x NEB buffer 2 (New England Biolabs, www.neb.com). The p201N:Cas9 plasmid was linearized by digestion with Spe1 (www.neb.com ...
-
bioRxiv - Microbiology 2019Quote: ... The Illumina RA3 adapter sequence was ligated to the purified RNA using T4 RNA Ligase 2 (NEB, cat. number: M0242) for 2 hours at 25 °C and reverse transcription was performed with Reverse Transcription Primer (Illumina sequence ...
-
bioRxiv - Molecular Biology 2020Quote: ... NOCT Δ(2-15)-3F was PCR amplified from NOCT Δ(2-15)-3F pFC3F and inserted into pCW57.1 using Gibson Assembly using the NEBuilder HiFi Assembly Master Mix (NEB, E5520). NOCT (1-431)-3F pcDNA5/FRT/TO was generated through PCR amplification of NOCT (1-431 ...
-
bioRxiv - Bioengineering 2021Quote: ... which were subsequently cloned into a custom vector (Supplementary sequence 2, BfuAI and EcoR I digested) by the Gibson assembly method (NEB). To generate nicking sgRNA expression plasmids ...
-
bioRxiv - Synthetic Biology 2020Quote: Phosphorylate oligos by mixing 1-2 ul of each top-strand oligo along with 1x T4 ligase buffer and 1 ul T4 polynucleotide kinase (NEB). Polynucleotide kinase buffer will not work without supplementary ATP ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Transformations for integration onto p1 were performed as described previously:15 2–4 µg of plasmid DNA with ScaI restriction sites adjacent to integration flanks was cut with ScaI-HF (NEB) and transformed into yeast harboring the wt p1 and p2 plasmids ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Integration of the sequences and removal of sacB gene was confirmed by colony PCR (SI Fig 2) with OneTaq Hot Start Quick-Load 2X Master Mix with GC buffer (New England BioLabs) using a Touchdown thermocycling protocol with an annealing temperature ranging from 72-62°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 uL aliquots were removed at each time point and added to 2 uL 5 mg/mL Proteinase K (NEB) in 5% SDS ...
-
bioRxiv - Plant Biology 2021Quote: ... 0.3-kb promoter-xopL gene was PCR amplified using Xcv 85-10 genomic DNA as template and cloned into pBBR1MCS-2 (76) linearized with EcoRV (New England Biolabs) using Gibson assembly ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 0.2 μl 50x oligos (AarI recognition site) for Level 0 and Level 2 cloning or Eco31I/BsaI-HFv2 (ThermoFisher Scientific/NEB) for Level 1 cloning ...
-
bioRxiv - Genomics 2019Quote: ... D7 and D5 pre-annealed indexed adapters (2 ng and 200 ng, respectively) and T4 DNA ligase (400 U, NEB), and were incubated at 16°C overnight ...
-
bioRxiv - Biochemistry 2019Quote: ... In the case of Biotinylated-AviTag-haBiP(28-635)T229A-V461F this protein was also made nucleotide free by the addition of 2 U CIP (NEB) per mg of BiP ...
-
bioRxiv - Genomics 2021Quote: ... The PCR mix (8 µl H2O, 2 µl primer mix P5Solexa/P3Solexa, 10 µM each, 20 µl Phusion HF Mix [New England Biolabs]) was added to 10 µl cDNA ...
-
bioRxiv - Genomics 2021Quote: ... Purified RNA was fragmented 2-4 minutes (depending on the RNA Integrity Number) using NebNext Magnesium RNA Fragmentation Module (New England Biolabs) and once again purified with the RCC kit (Zymo Research ...
-
bioRxiv - Genetics 2020Quote: ... containing the silent mutations to stem 2 of SARS and SARS-CoV2 (IDT) into the plasmid using T4 DNA ligase (NEB).
-
bioRxiv - Evolutionary Biology 2021Quote: Libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA; Fig. 2). Size selection was not employed for samples with highly degraded DNA ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... Amplified guide RNAs were cloned in a 100 μl assembly reaction with 1.0 μg linearized pNTI661 and 1.7 μl guide RNA PCR using 2 × NEBuilder HiFi DNA Assembly Master Mix (NEB E2621L), which was incubated for 1 hour at 50 °C and then purified with a DNA Clean & Concentrator with final elution into 10 ...
-
bioRxiv - Cancer Biology 2021Quote: ... samples were mixed with 7 μl 5x Ultra II FS buffer and 2 μl Ultra II FS enzyme (New England BioLabs), and incubated 12 minutes at 37 °C followed by 30 minutes at 65 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... F0 founders were identified by outcrossing TALEN or CRISPR/Cas9-injected fish with wildtype fish and screening the offspring for mutations at 2 dpf using T7 endonuclease I (NEB) assay (for TALEN-injected fish ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL from both ssDNA and reverse-transcribed RNA samples were used to template PCR amplification using Taq polymerase (NEB). The resulting amplicons were treated with either ClaI or DraI (NEB ...
-
bioRxiv - Genomics 2021Quote: ... Fragmentation was carried out by adding 50 μL NEB Buffer 2 and 8 μL of 25 U/μL MboI restriction enzyme (New England Biolabs). Samples were incubated at 37 °C for 2 hours with rotation ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM of purified protein was combined with 2 mM DTT and 10 mM SNAP-Surface Alexa Fluor 546 (New England Biolabs) in PBS for 60 min at 30°C ...
-
bioRxiv - Microbiology 2021Quote: Cloning of the plf gene clusters and plfG and papG genes encoding the different classes of adhesins were obtained by PCR amplification using specific primers (Table 2) and Q5 High Fidelity-DNA polymerase (New England Biolabs [NEB]). The A-Tailing Kit (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein expression was induced with 0.3 mM IPTG for 2 hours at 37°C and recombinant MBP-rabaptin5 was purified with an amylose resin (New England Biolabs) according to manufacturs instructions and dialysed against lysis buffer (20 mM Tris-HCl ph7.4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA encoding aa 1-862 of mouse ZO-1 was amplified by PCR using KOD-Plus-Ver.2 DNA polymerase and subcloned into pMAL-cRI (New England BioLabs). Expression vectors for MBP-fusion proteins of PDZ1 ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR product was either separated on a 2% agarose gel for 3 hours or digested overnight with MwoI (New England Biolabs) and separated on an agarose gel to determine individual fish genotypes ...
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were generated with the primers listed in Supplementary Table 2 using HF Phusion DNA polymerase (New England Biolabs).
-
bioRxiv - Genomics 2019Quote: ... The library was prepared using the NEBNext Ultra II kit and indexes from the Dual Index Primers Set 2 (all New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The ligation mixture was then used in a PCR reaction with primers 2569/2570 (Table 2) and Phusion DNA polymerase (New England BioLabs). PCR was carried out in 50 μl reactions for 3 min at 98°C followed by 30 cycles of 1 min at 98°C ...
-
bioRxiv - Microbiology 2020Quote: High throughput sequencing libraries were prepared using RNA isolated from total RNA or PAR-CLIP samples using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 2; cat# E7580, New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... A 2-micron Ura3-selective plasmid was constructed from three DNA fragments using HiFi DNA Assembly Master Mix (New England Biolabs) for cloning ...
-
bioRxiv - Genomics 2021Quote: ... 10% Dextran sulfate Sigma D8906; 0.02% BSA Ambion AM2616; 1 mg/ml E.coli tRNA Sigma R1753; 2 mM Vanadyl-ribonucleoside complex NEB S1402S; 2XSSC) containing diluted probes and incubated over night at 30°C ...
-
bioRxiv - Genomics 2021Quote: ... The isolated mRNA was then used to prepare sequencing libraries using NEBNext Ultra II Non-directional RNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (Index sets 1 and 2) (NEB). Next ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Each PCR amplification product was digested overnight at 37 °C with 2 μl of CutSmart® uffer (New England Biolabs) and 0.2 μl of AccI enzyme (10 U/mL ...
-
bioRxiv - Bioengineering 2021Quote: ... was carried out (25 ng linearized vector, 10 ng purified insert, 10 µL 2 x Gibson Assembly Master Mix (New England BioLabs) and up to 20 µL H2O were mixed and incubated at 50°C for 1 hour) ...
-
bioRxiv - Cell Biology 2021Quote: ... using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers) and cloned by Gibson Assembly Cloning Kit (EE5510S, NEB). All primers were designed using SnapGene (GSL Biotech LLC ...
-
bioRxiv - Microbiology 2020Quote: ... each reaction tube of 20 µl contained 10 µl of Q5 High-Fidelity 2× Master Mix (New England BioLabs Inc.), 20 pmol of forward and reverse primer ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... Dissociated cells were resuspended in 1ml of Cell Hashing Staining Buffer (1× PBS with 2% BSA (New England Biolabs, B9000S) and 0.02% Tween (Tween®-20 Solution ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA (1-2 μg) was reverse-transcribed using LunaScript™ RT SuperMix Kit (New England Biolabs, Catalog No; E3010S). Quantitative real-time RT-PCR (qRT-PCR ...
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...