Labshake search
Citations for New England Biolabs :
1551 - 1600 of 1868 citations for Natural Cytotoxicity Triggering Receptor 2 NCR2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... and this point mutation introduces a premature stop codon and abolishes an Hpy118I site and the line was genotyped by PCR (primers in Table 2) and Hpy118I digest (NEB) (Supp Fig 1B) ...
-
bioRxiv - Immunology 2024Quote: ... The irf8 st95 mutation abolishes an AvaI restriction site and this line was genotyped by PCR (primers in Table 2) and AvaI digest (NEB), as previously described (Shiau et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 2μg (dual-guide) per well were set up using the Q5 Hot Start High-Fidelity 2× Master Mix (NEB #M0494) in a total volume of 50μl ...
-
bioRxiv - Biochemistry 2024Quote: ... pETDuet-1 vector was linearized by digestion with PacI and NdeI and gene fragments were inserted into multiple cloning site 2 (MCS2) of the linearized plasmid via Gibson assembly using the New England BioLabs (NEB) Gibson Assembly Master Mix and following the manufacturer’s standard protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 µg of total RNA was circularised in a reaction containing 6 U T4 RNA Ligase 1 (New England Biolabs), 50 µM ATP ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was diluted 1:50 in ddH2O and 2 µL used as a template in a 15 µL reaction using the Luna Universal qPCR Master Mix (NEB) on a Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by excision and ligation for 2 hours at room temperature using the Instant Sticky-end Ligase Master Mix (NEB) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified extension products were denatured and ligated to adaptor 2 (Ad2, Supplementary Table 3) by Instant Sticky-end Ligase Master Mix (New England Biolabs) at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... The NEBuilder Assembly Tool was used to design primers for amplification of each component of the donor plasmid (Table 2) using Phusion (NEB); purified PCR products were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Deletion constructs were made by PCR amplification of the appropriate regions and cloned into the Cilantro 2 vector using Gibson cloning (New England Biolabs). Lentiviral particles carrying the respective constructs in the Cilantro 2 vector were produced and used to transduce MOLM-13 cells as described above ...
-
bioRxiv - Microbiology 2024Quote: ... The SARS-CoV-2 Spike coding region was then amplified using Q Hot Start High-Fidelity DNA Polymerase (New England Biolabs) with forward (5’ TCATCGATGCATGGTACGCCACCATGTTTGTTTTTCTTGTTTTATTG 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA pellet was resuspended in 50 µl of RNase-free H2O and 1 µl of the resuspended samples was used for quantification of the DENV-2 D220 NS5 RNA regions using Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in a 10-ul reaction volume ...
-
bioRxiv - Microbiology 2024Quote: ... was amplified using primers OVL7966 and OVL6481 and the PCR product was excised from a 2% agarose gel using the Monarch DNA cleanup and gel extraction kit (NEB). One-step Golden Gate Assembly (GGA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The addition of an NLS or DST to level 1 and level 2 integrase constructs was performed using PCR-mediated site-directed mutagenesis (NEB Q5 Site-Directed Mutagenesis ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 0.2 μl 50x oligos of the AarI recognition site for Level 0 and Level 2 cloning or Eco31I/BsaI-HFv2 (ThermoFisher/NEB) for Level 1 cloning ...
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Molecular Biology 2022Quote: ... The commercial antibodies used in this study are Pan anti-butyryllysine (PTM Biolabs, SKU: PTM 301), Butyryl-Histone H4 (Lys 12 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Antibodies were then co-incubated with a 20-fold molar excess of BG-GLA-NHS (NEB) for 30 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by Western plot transfer to nitrocellulose and probed with an MBP antibody (New England BioLabs) (Extended Data Fig ...
-
Systematic Analysis of Lysine Succinylation in Vero cells infected with Small Ruminant MorbillivirusbioRxiv - Genomics 2021Quote: Lysine-succinylated peptides were enriched using agarose-conjugated pan anti-succinyllysine antibody (PTM Biolabs, Hangzhou, China). In brief ...
-
bioRxiv - Molecular Biology 2021Quote: ... The antibodies were captured using 50 µl of protein G magnetic beads (S1430, New England Biolabs) incubated for 60 min with end over end mixing at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... Purified RNA then was pulldown using m6A specific antibody using EpiMark N6-methyladenosine enrichment kit(NEB). RNA was converted into cDNA using random hexamer primers and Revert aid RT (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies used for immunoblots in this study were anti-tau (tau46) (1:5000; NEB 4019S), anti-human tau (tau13 ...
-
bioRxiv - Neuroscience 2023Quote: ... The lysate-antibody mix was then incubated with Magnetic Protein A beads (New England Biolabs, S1425S) overnight at 4 °C with end over rotation ...
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... and a secondary Alexa Fluor 555 conjugated anti-mouse IgG antibody (NEB #4413S; diluted 1:1000). The percentage of infected cells was calculated using an open-source Fiji macro (83).
-
bioRxiv - Biophysics 2021Quote: ... The Biotin-handle and Cosmid-I95 DNA were both digested for 2 hours at 37°C with SpeI-HF (NEB, R3133L) and subsequently heat inactivated for 20 minutes at 80°C ...
-
bioRxiv - Cell Biology 2019Quote: ... stained with oligo-conjugated WGA at a concentration of 2-5 μg/mL in 1× HBSS with 2000× diluted murine RNase inhibitor (New England Biolabs, M0314L) at 37 °C for 20 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ adapter ligation was performed by adding 3 uL of 10uM 5’ adaptor (which was previously denatured by heating to 70 C for 2 minutes and placed on ice, NEB E7330L), 2 uL of 10X T4 RNA ligation buffer (NEB B0216L) ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR products were run on 2% agarose gels and the Quick load 100pb DNA ladder (New England Biolabs Inc., Ipswich, MA) was used for fragment size visualization ...
-
bioRxiv - Molecular Biology 2021Quote: ... All these reactions were performed in a single step by adding 2 µL of enzyme mix (1 µL of Thermolabile USER II (New England Biolabs, M5508L), 0.5 µL of Exonuclease I (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was equilibrated with 100 μl CutSmart buffer containing 5 mM DTT and 1 mM dATP for 1 hour at room temperature before incubation for 2 h at 37°C in another 100 μl of the same buffer containing 1 μl Klenow exo-(NEB M0212S) and 1 μl T4 PNK (NEB M0201S) ...
-
bioRxiv - Physiology 2020Quote: ... Germany) 1.5% agarose gel using purple gel loading dye and 2-Log DNA ladder (both New England Biolabs, Ipswich, MA, USA) at 80 V and 85 mA for 2h ...
-
bioRxiv - Neuroscience 2019Quote: ... Fixed neurons were then permeabilized and blocked simultaneously (2% normal goat serum, 5425S, New England Biolabs, and 0.1% Triton X-100) before incubation in primary antibody solutions overnight and subsequent incubation with secondary antibodies the following day.
-
bioRxiv - Cell Biology 2019Quote: ... Each sample was then split into two and incubated in the presence or absence of 2 μl of EndoH (50 U/μl: NEB#P0702S) for 1h at 37 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were resuspended in 1 volume of buffer A / 300 mM NaCl / 2 mM MnCl2 / 1 mM DTT and incubated with λ protein phosphatase (NEB) at 50 U / mL for 1 hour at 23°C with agitation ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.5 mg of pNL003 plasmid (38) was linearized by incubation at 37 °C for 2-4 h in the presence of EcoRV (NEB R0195S). Transcription reactions (10 mL ...
-
bioRxiv - Microbiology 2021Quote: ... The amplification of bacterial DNA was achieved by targeting the V3–V4 region of 16S rRNA gene with 30 µL final volume containing 15 µL of 2× master mix (BioLabs, USA), 3 µL of template DNA ...
-
bioRxiv - Genomics 2021Quote: Restriction digestion was carried out by adding 25 μL of 10 ×NEBuffer 2 and 100 U of the MluCI restriction enzyme (NEB, R0538) and incubating for ≥2 hours at 37°C in a Thermomixer at 900 rpm ...
-
bioRxiv - Zoology 2021Quote: ... amplicons were analyzed by 1.5% agarose gel electrophoresis with ethidium bromide staining and using a DNA ladder marker (2 log, 100 bp, or 1 kb DNA ladder from New England Biolabs, USA). Expected PCR product sizes of the first step and nested PCR step were 514 and 148 bp ...
-
bioRxiv - Synthetic Biology 2022Quote: Templates for expression of MGVDYKDDDDK were prepared by annealing and extending the oligonucleotides MGVflag-1 and MGVflag-2 using Q5® High-Fidelity 2X Master Mix (NEB) (Supplementary Table 1) ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was eluted from AMPure XP beads with 80 μL elution buffer and digested with the restriction enzymes 2 μL MluCI (NEB, R0538L) and 2 μL NlaIII (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... Both primers were annealed to a DNA template and ligated by RNA ligase 2 of bacteriophage T4 (New England BioLabs Inc.). White and gray blocks represent RNA and DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Beads were washed as described above and either directly resuspended in Proteinase K reaction or in 20 μl of RecJ adapter removal reaction (1X NEB Buffer 2 (NEB, #B7002S), 25U 5’ Deadenylase (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... Linearised plasmid was mixed with 2-3-fold excess of the three insert fragments followed by addition of Gibson Assembly® Master Mix (New England Biolabs) and incubation at 50°C for 60 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... primers pM102F and pM102R (Supplementary Table 2) were designed and used in a long-range PCR reaction using the LongAmp® Taq DNA Polymerase (NEB) to amplify 40 ng of genomic DNA following the kit instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Yields of viral RNA were quantified by real-time qPCR by using SARS-CoV-2 specific primers targeting the E gene with the Luna®Universal One-Step RT-qPCR Kit (New England Biolabs) in a LightCycler 480 thermocycler (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3′ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L). Linker-ligated footprints were reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 40 µL of ChIP DNA or about 400 ng of Input DNA were added to 70 µL of blunting mix (11 µL 10X NEBuffer 2 (NEB, B7002S), 0.5 µL 10 mg/mL BSA ...