Labshake search
Citations for New England Biolabs :
1301 - 1350 of 1722 citations for 3 4 Dehydro Cilostazol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... cDNA was PCR amplified using the primers directed against 5′ and 3′ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... signal was synthesized by Integrated DNA Technologies and inserted at the 3’UTR of the L1 mRNA using Hifi Assembly mix (NEB). gBlocks gene fragments containing different PBS site sequences were synthesized by Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: Libraries of immunoprecipitated DNA were generated from 3 ng of starting DNA with the NEBNext Ultra DNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions at the CRG Genomics Core Facility (Barcelona ...
-
bioRxiv - Molecular Biology 2024Quote: ... primer O3P (Supplementary Table 3) was attached to IP-purified DNA and was extended by NEBNext Ultra II Q5 Master Mix (New England Biolabs), followed by ExoI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified extension products were denatured and ligated to adaptor 2 (Ad2, Supplementary Table 3) by Instant Sticky-end Ligase Master Mix (New England Biolabs) at 4 °C overnight ...
-
bioRxiv - Immunology 2024Quote: ... the wild type and mutant pBlueScript SK(+) HEV plasmids were linearized at their 3′ end with the MluI restriction enzyme (NEB) and transcribed with the mMESSAGE mMACHINE T7 Transcription kit (Ambion #1344) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The variant library was ligated into each vector with a 1:3 (insert: vector) T4 ligation at 16°C overnight (NEB). Ligations were DNA cleaned (Zymo) ...
-
bioRxiv - Microbiology 2019Quote: ... overnight at 4°C followed by Alexa Fluor 488 goat anti-rabbit secondary antibody (New England Biolabs, UK) for 1h ...
-
bioRxiv - Molecular Biology 2019Quote: ... centrifuged 10min at 4000g and incubated with oligo(dT)25 beads 30min at 4°C (New England Biolabs). Remaining steps for polyA RNA isolation were performed as described [18] ...
-
bioRxiv - Genomics 2020Quote: ... CpG dinucleotides were methylated by incubating 1µg of DNA with S-Adenosyl methionine (SAM) (32µM) with CpG Methyltransferase (M.SssI) (4-25 units) (New England BioLabs) at 37°C for 1h before heating to 65°C for 20mins.
-
bioRxiv - Genomics 2020Quote: ... by incubating 1µg of DNA with S-Adenosyl methionine (SAM) (32µM) with CpG Methyltransferase (M.SssI) (4-25 units) (New England BioLabs) at 37°C for 1h before heating to 65°C for 20mins.
-
bioRxiv - Cell Biology 2020Quote: ... The extract was incubated for 1 h at 4 °C with amylose resin (New England Biolabs, Ipswich, MA), loaded onto a column ...
-
bioRxiv - Systems Biology 2020Quote: Single hematopoietic stem and progenitor cells were index-sorted into 384 well plates containing 0.5 µl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB), spun down and frozen at −80°C ...
-
bioRxiv - Systems Biology 2021Quote: ... Then a plasmid library was assembled using 4 independent reactions of NEBuilder HiFi DNA Assembly (New England Biolabs) to avoid biases in assembly that might affect the library’s distribution ...
-
bioRxiv - Biochemistry 2022Quote: ... The unbound fraction was then incubated for 1 hour at 4 °C with lambda phosphatase (New England Biolabs), calf intestinal phosphatase (New England Biolabs) ...
-
bioRxiv - Cell Biology 2022Quote: ... pEXKm5 was digested with HindIII and the 4 fragments were assembled via Gibson cloning (New England Biolabs, E2611S).
-
bioRxiv - Microbiology 2022Quote: ... DNA was synthesized from extracted RNA using 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was synthesized from extracted RNA using 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Neuroscience 2021Quote: ... nuclei were resuspended in 200uL digestion buffer with 4 uL protease (an equal volume of protease K (NEB) was substituted if the manufacturer-provided protease was exhausted ...
-
bioRxiv - Genomics 2019Quote: ... (iii) Polymerase for Ad2 amplification: Libraries #1 and #4 were amplified using Q5 high-fidelity DNA polymerase (NEB). Library #2 was amplified using Pfu Turbo Cx ...
-
bioRxiv - Molecular Biology 2020Quote: ... the single cell tagmentation product was mixed well with 4 units of Bst 3.0 DNA Polymerase (NEB, Cat.No.M0374) and indexed common primers (Vazyme ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 million permeabilized cells (without any antibodies bound) were incubated with 4 units of Dam enzyme (NEB, M0222L) during the activation step ...
-
bioRxiv - Genomics 2021Quote: ... We then performed a kinase treatment adding 4 μl of T4 Polynucleotide Kinase (PNK, New England BioLabs Inc.), 5 μl of 10X PNK buffer ...
-
bioRxiv - Plant Biology 2019Quote: ... Purified DNA fragments were ligated overnight at 4°C with T4 DNA ligase (New England Biolabs, Ipswich MA) per manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and 4 µl of hot PNK mix (0.2 µl PNK [New England Biolabs] ...
-
bioRxiv - Synthetic Biology 2021Quote: ... annealed by temperature decrease from 95 °C to 4 °C and phosphorylated using T4 Polynucleotide Kinase (NEB, M0201) according to manufactures’ protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 12 h at 4 °C with 10 μg of Factor Xa protease (New England Biolabs, Hitchin, UK) per 1 g of mitochondria ...
-
bioRxiv - Biochemistry 2021Quote: ... The resulting Gβ1γ2 was then incubated for 1 hour at 4 °C with lambda phosphatase (New England Biolabs), calf intestinal phosphatase (New England Biolabs) ...
-
bioRxiv - Genomics 2021Quote: ... Nicks were then ligated for 30 min at 37 °C using 4 units of Taq DNA ligase (NEB) in the presence of 0.5 μl thermopol buffer ...
-
bioRxiv - Immunology 2021Quote: ... into 384 well plates containing 0.5 µl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB), spun down and frozen at −80°C ...
-
bioRxiv - Biophysics 2020Quote: ... SecA(N95) K797C was overexpressed for 4 hours at 37 °C in E.coli NiCo21 cells (New England Biolabs) grown in 2xYT (Acumedia ...
-
bioRxiv - Molecular Biology 2023Quote: ... A mixture containing 1 μl of a 4-fold dilution of Low Range ssRNA Ladder (New England Biolabs) and 0.75 pmol each of RPIX_SC1_Bridge ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 and subjected to T7E1 digestion in a 20 ul reaction according to the manufacturer’s protocol (NEB cat.M0302). Digestion products were resolved on 8% acrylamide/bis TBE gel and visualized with EtBr.
-
bioRxiv - Systems Biology 2024Quote: ... PLP ligation was performed for 4 hours at room temperature using 0.5 U/µl SplintR Ligase (NEB, M0375), 1x Ampligase ligase buffer ...
-
bioRxiv - Biophysics 2024Quote: ... A 4°C AKTA Pure FPLC system (Cytiva) was prepared with a 10 mL amylose column (NEB #E8021S) and 2 mL/min flow rate ...
-
bioRxiv - Microbiology 2023Quote: ... cDNAs and primers (listed in Table 4) were mixed with Luna Universal qPCR Master mix (New England Biolabs) and amplification was carried out in duplicate in a CFX96 Real-Time System C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Biophysics 2023Quote: ... The resulting 40 μl of reaction product was mixed with 4 μl of T5 Exonuclease (New England Biolabs) in NEB Buffer 4 ...
-
bioRxiv - Biochemistry 2023Quote: ... and a final concentration of 1.4 nM of hRNase 4 and 0.15 U/μL of polynucleotide kinase (New England Biolabs). The reactions were incubated at 37°C for 1 h and stopped by addition of murine RNase inhibitor to a final concentration of 2 U/μL and incubation at room temperature for 10 minutes ...
-
bioRxiv - Genetics 2023Quote: ... The ints-4 sgRNA was inserted into plasmid pDD162 via the Q5 Site-Directed Mutagenesis Kit (NEB, E0554S). The sgRNA plasmid and repair template were Sanger sequenced to confirm correct construct assembly followed by microinjection into EG9882 strain with integrated Cas9 activity (10 ng µl-1 repair template ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were expressed and purified from 2 to 4 liters of Escherichia coli NiCo21(DE3) (New England Biolabs) as previously described (24) ...
-
bioRxiv - Microbiology 2023Quote: ... U6-del-F and U6-del-R (Supplementary table 4) were annealed and phosphorylated using T4 PNK (NEB) and ligated into the restricted plasmid using T7 DNA ligase ...
-
bioRxiv - Developmental Biology 2024Quote: ... The hsp-4 dsRNA was synthesized in vitro with a HiScribe™ T7 RNA Synthesis Kit (NEB, E2050). Subsequently ...
-
bioRxiv - Neuroscience 2024Quote: ... Pellets were resuspended in NEB buffer prior to centrifugation at 11,500 rpm for 20 minutes at 4°C on a sucrose gradient (1.6M sucrose in NEB and 0.8M sucrose in NEB). Nuclei-containing pellets were fixed with 0.3% formaldehyde in NEB and rotated at room temperature for 10 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... The unbound fraction was then incubated for 1 h at 4 °C with lambda phosphatase (New England Biolabs), calf intestinal phosphatase (New England Biolabs) ...
-
bioRxiv - Genomics 2021Quote: ... and washed 3 times with ice-cold 10 mM Ribonucleoside Vanadyl Complex (RVC) (New England BioLabs, cat.no. S1402S, Ipswich, Mass, USA) in buffer A (10 mM NaCl ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 µl was mixed with 40 µL of 1x NEBuffer 3 supplemented with 10 mM MgCl2 and 5 units of Mbo I (New England BioLabs #R0147L). This reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3’UTRs were combined to the TagRFP-T CDS using the Gibson assembly Master Mix (Cat#E2611, New England BioLabs Inc). The resulting fragment was then amplified via PCR and digested prior ligation into a vector containing only Hofstenia promoter region ...