Labshake search
Citations for New England Biolabs :
1251 - 1300 of 1722 citations for 3 4 Dehydro Cilostazol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The purified ribodepleted RNA samples were fragmented for 3 minutes at 94°C in Magnesium RNA Fragmentation Module (New England Biolabs) and 3’ ends were dephosphorylated with T4 polynucleotide kinase (Lucigen) ...
-
bioRxiv - Immunology 2023Quote: ... were incorporated onto the mab-oligos via a 50 μl gap-fill ligation reaction consisting of 40 U Taq ligase (New England Biolabds) 3 U T4 DNA polymerase (New England Biolabs), 100 μM dNTPs ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Microbiology 2023Quote: ... PCRs were performed using specific reaction primer pairs specific to the appropriate parental segment (Table 3) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Developmental Biology 2023Quote: ... 3 µl of the purified assembly is incubated with 50 µl of NEB 10-β-competent E.coli cells (NEB, C3019H) for 30 min at 4 ℃ ...
-
bioRxiv - Cell Biology 2023Quote: ... Donor sequences were then inserted at the HindIII (5’) and XhoI or BamHI at (3’) sites using HindIII-HF and XhoI-HF or BamHI-HF (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... The 32P-radioabelled RNase III.RNA complexes were washed and unique barcoded 5’ linkers and 3’ App-PE adapters were ligated to the bounded RNA using 40 U T4 RNA ligase I (NEB) for each ligation step ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... while the pML104-PDR1 vector has a guide sequence 5’- CTGGATAAACGTCGCTCCAC-3’ introduced by Q5 polymerase PCR (New England Biolabs) and In-Fusion Snap Assembly (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... was synthetized by introducing a 984 bp fragment from the 3′ end of the GEXP15 ORF into pGDB between the XhoI/AvrII (New England Biolabs). PetDuet-1 was purchased from Novagen.
-
bioRxiv - Biochemistry 2023Quote: ... The oligonucleotides were labeled at the 3’ terminus with [α-32P] dCTP (Hartmann-Analytic) by terminal transferase (New England Biolabs) prior to annealing ...
-
bioRxiv - Cell Biology 2023Quote: ... then the reactions were made to a total volume of 80 µL containing 1 equivalent of GlycoBuffer2 and 3–5 µL of Remove-iT PNGase F (P0706, NEB), incubated at 37°C for 2 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... Two gRNAs targeting UBAP2L (5’-TGGCCAGACGGAATCCAATG-3’ and 5’-GTGGTGGGCCACCAAGACGG-3’) were cloned into pX330-P2A-EGFP/RFP (Zhang et al, 2017) through ligation using T4 ligase (New England Biolabs) using the following primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Biochemistry 2023Quote: ... 5′ phosphorylated and 3’ A-tailed by NEBNext Ultra II End Prep Enzyme Mix following the manufacturer’s instruction (New England Biolabs #E7645L). An adaptor was ligated ...
-
bioRxiv - Biochemistry 2023Quote: ... 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′) and the Luna Universal Probe one-step RT-qPCR kit (catalog no. E3006; New England Biolabs). A 20-μL RT-qPCR mixture contained 7 μL of sample ...
-
bioRxiv - Biochemistry 2023Quote: ... The array DNA was composed of a fluorescent nucleotide Alexa Fluor 647-aha-dCTP (ThermoScientific) and was generated using Klenow Fragment 3’ – 5’ exo- (NEB). Nucleosome arrays were mixed with SUV420H1 or 5μM HP1α and incubated at room temperature for 20 mins before transferring to a glass bottom 384 well plate for imaging ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... and PCR amplification of the WPRE sequence and barcode with insertion into the ClaI sites proximal to the 3’ LTR by HiFi DNA Assembly (New England Biolabs). ORFs were cloned into the EcoRI site of the double-barcoded lentiviral vectors by HiFi DNA Assembly ...
-
bioRxiv - Molecular Biology 2023Quote: ... nascent RNA was isolated with streptavidin beads and barcoded adapters ligated at 3’ ends of the nascent RNA (T4 RNA ligase 1 enzyme, M0204L; NEB) overnight at 25° C ...
-
bioRxiv - Plant Biology 2023Quote: ... the RNAs were dephosphorylated and the L3 linker (Supplementary Data 1) ligated to the 3’ ends using RNA ligase (NEB). The RNA 5’ ends were radiolabeled using [γ-32P]-ATP and polynucleotide kinase and the covalently-linked protein-RNA complexes separated on a 4-12% NuPAGE Bis-Tris gel (Thermo Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... Promoters and 3’ UTRs were amplified from Col-0 genomic DNA using the primers listed in (Supp Table 3) with Q5 Hot Start High-fidelity DNA polymerase (NEB). For MBD5 and SUVH3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a synthetic 391 bp double-stranded DNA fragment encoding 5′-(1st gRNA/scaffold/H1 promoter/2nd gRNA)-3′ was inserted using the NEBuilder HiFi assembly system (NEB). Synthetic DNA fragments were ordered from Genewiz and sequences are listed in Table S6 ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q, New England Biolabs) at 22 °C for 3 h ...
-
bioRxiv - Genetics 2023Quote: ... and SWI4 3’UTR (1000 bases downstream of ORF) were cloned into a LEU2 single integration vector by Gibson assembly (NEB) (Gibson et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... reverse 5’-GTGGCC CTCGAG TCA GTG AGT TTC ATG TTG G-3’ and then purified using the Monarch PCR plus DNA purification kit (NEB). The purified PCR product was digested by KpnI and XhoI (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... Double stranded on-bead DNA was digested with a mix of 3 blunt cutting enzymes (SspI-HF, StuI, and HincII) (NEB) to generate blunt-end DNA ...
-
bioRxiv - Microbiology 2023Quote: Lysates of U2OS cells infected with wild-type HSV-2 186 at an MOI of 3 for 24 h were treated with calf intestinal alkaline phosphatase (CIP) (New England BioLabs) as described previously60.
-
bioRxiv - Molecular Biology 2023Quote: ... 5′ phosphorylated and 3’ A-tailed by NEBNext Ultra II End Prep Enzyme Mix following the manufacturer’s instruction (New England Biolabs #E7645L). An adaptor was ligated ...
-
bioRxiv - Genomics 2023Quote: ... The DNA with end tags was oxidized in 15 μL TET2 reaction mix (3 μL TET2 reaction buffer plus reconstituted TET2 reaction buffer supplement (NEB), 0.3 μL oxidation supplement (NEB) ...
-
bioRxiv - Bioengineering 2023Quote: ... The error-prone PCR (with an error rate of 3- to 5-nucleotide mutations per kilobase) was carried out with the Taq DNA polymerase (New England BioLabs) in a reaction containing 2 µl of 10 mM primers ...
-
bioRxiv - Microbiology 2023Quote: ... A second DNA adapter (containing a random-mer of 10 (N10) random bases at the 5′ end) was then ligated to the cDNA fragment 3′ end (T4 RNA Ligase, NEB) in the presence of a high concentration of PEG8000 and dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Microbiology 2024Quote: The msdDNA cDNA was isolated from acrylamide gels and 100 ng was used to extend the 3’ end with dCTP or dGTP and terminal deoxynucleotidyl transferase (TdT) from NEB, according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 15 µl of anti-MBP couped beads (pre-blocked for 1h in RIPA with 3 % BSA; NEB) for 2 h ...
-
bioRxiv - Developmental Biology 2024Quote: ... along with 5 ng/μl Pmyo-3::GFP and 20 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate the DLS344 strain ...
-
bioRxiv - Cell Biology 2024Quote: ... The inserts and the backbone were mixed in a 3:1 ratio and incubated with the 2x NEBuilder HiFi DNA assembly enzyme mix (New England Biolabs) for 1h at 50°C ...
-
bioRxiv - Cell Biology 2024Quote: ... the newly produced CENP-A-SNAP pool was labelled by exposing the mitotic cells to media containing 3 µM SNAP-Cell 647 (NEB) and 5 µM STLC (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using a 5′ DNA adenylation kit at the 5′ end (NEB). To reduce ligation bias ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the radiolabeled 3’ fragment was ligated to an unlabeled 5’ fragment by splinted ligation with T4 DNA ligase (NEB) at 30°C for 2 h ...
-
bioRxiv - Genomics 2024Quote: ... The backbones for the Gibson reaction for GRB2-SH3 and PSD95-PDZ3 library assembly (aPCA plasmids) were first linearized using primers listed in Extended Data Table 3 and next treated with Dpn1 (NEB) restriction enzyme to remove the circular plasmid template ...
-
bioRxiv - Cell Biology 2024Quote: ... we microinjected 5 ng/μl Pmyo-3::GFP and 95 ng/μl of 2-Log DNA ladder (New England BioLabs) into the germline of GRD-3::mKate2 animals to generate transgenics expressing a muscle-specific GFP marker.
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then ligated to the 3’ end of the cDNA by using Thermostable 5’ App DNA/RNA Ligase (New England Biolabs) for 2 h at 65°C ...
-
bioRxiv - Biophysics 2024Quote: ... A 30 nt 3′ overhang was created by treating the purified PCR product with USER enzyme mix (NEB, Cat# M5505S) for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The oligonucleotide-based DNA substrate used for the helicase and nuclease assays was generated by labeling the BIO100C oligonucleotide (see Table S1 for oligonucleotides sequence) at the 3’ end using terminal transferase (New England Biolabs) and [α-32P]dCTP (Hartmann Analytic ...
-
bioRxiv - Molecular Biology 2024Quote: ... A second adapter was then ligated to the 3’OH of the cDNAs (with NEB HC RNA Ligase in NEB ligation buffer plus 5% DMSO ...
-
bioRxiv - Immunology 2024Quote: ... A custom ribonucleoside blend was used comprising 3′-O-Me-m7G(5′)ppp(5′)G cap analog (New England Biolabs), ATP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and then adenylated at the 5′ end with a 5′ DNA adenylation kit (NEB). Four random nucleotides were added in the 3′ and 5′ adapters [(5′ -rAppNNNNTGGAATTCTCGGGTGCCAAGG/amino CA linker-3′ ...