Labshake search
Citations for New England Biolabs :
1301 - 1350 of 6189 citations for 1 3 Bis 2 4 hydroxyphenyl 2 propyl benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized on 2 µg of total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fragments were assembled using the NEBuilder® 2 X HiFi DNA assembly master mix (NEB, Cat. No. #E2621). The resulting plasmid will be referred to as pBd-phoD-HA-BSD.
-
bioRxiv - Molecular Biology 2023Quote: ... Fragments were assembled using the NEBuilder® 2 X HiFi DNA assembly master mix (NEB, Cat. No. #E2621). The homology and guide RNA were inserted as described for pBdEF-Cas9-BSD-phodR ...
-
bioRxiv - Genomics 2023Quote: ... the oligo pool for each library was amplified with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...
-
bioRxiv - Genomics 2023Quote: ... Approximately 7,500 cells were diluted with 1.25 ml of a dilution buffer containing 0.4x NEBuffer 2 (NEB, B7002S), 2 mg/ml BSA (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... with the inserts at 2 fold molar excess followed by multiple transformations into NEB stable competent E.Coli (NEB) to ensure at least 20x coverage of colonies for every sgRNA ...
-
bioRxiv - Bioengineering 2023Quote: All qPCR reactions were set up using 7.5 µl of 2 x Luna Universal qPCR master mix (NEB), 0.375 pmol forward primer ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were then digested by adding 2μL LysC (500ng/μL, Pierce) for 2 hours then 6μL trypsin (100ng/μL New England Biolabs) overnight ...
-
bioRxiv - Physiology 2023Quote: ... muGFP and homology arms were PCR-amplified using Q5 High-Fidelity 2× Master Mix (New England BioLabs, M0492L). Primers for PCR were designed using the NEBuilder Assembly Tool ...
-
bioRxiv - Cell Biology 2023Quote: ... beads were equilibrated in 1x PMP buffer (50 mM HEPES, 100 mM NaCl, 2 mM DTT, 0.01% Brij 35, pH 7.5; New England Biolabs). Kinase reactions were performed with 1 μL commercial CK1δ (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... To a 10 μL aliquot of the supernatant were then added 2 μL of loading dye (NEB, #B7021S) and 1 μL of 2% sodium N-dodecanoylsarcosinate ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Molecular Biology 2024Quote: A 2-fold excess of either m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs) or chemically synthesized cap4 hexa-nucleotide (see cap4 synthesis below ...
-
bioRxiv - Cell Biology 2024Quote: ... We performed the SNAP-tag labeling in vivo with 2 μM SNAP-Cell TMR-Star (New England Biolabs) and visualized histones incorporated into chromatin after a pre-extraction of soluble histones before fixation with 2% paraformaldehyde for 20’ as 32 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... extracted PCR product with 2 μl of NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... These two oligos were ligated with splint oligo1 at 37°C for 2 hours using T4 ligase (NEB; 1U/ml T4 DNA ligase and 13 T4 DNA ligation buffer) ...
-
bioRxiv - Molecular Biology 2024Quote: ... were directly added to the beads and incubated at 70 °C for 2 min before 7.8 µl of ligation master mix (0.097% RNA ligase buffer (NEB), 1.94 mM DTT ...
-
bioRxiv - Microbiology 2024Quote: ... all phages were treated with 2 uL of RNAase A (50,000 U/mL, New England BioLabs, Cat. M02403S) and 50 uL of NEB buffer ...
-
bioRxiv - Microbiology 2024Quote: ... the DNA adenylated oligonucleotide adenylate intermediate was de-adenylated (RNA sample, NEB Buffer 2, and 5’-deadenylase (NEB); incubation at 30 °C for 1 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were prepared by mixing 25µL of NEBNext High-Fidelity 2× PCR Master mix (M0541, New England Biolabs), 21µL CUT&Tag DNA ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was synthesized on 2 µg of total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: CD52 - Fc fusion protein (20µg) was cleaved with 2 µL of FXa protease (New England Biolabs, Ipswich, USA) in a volume of 350 µL of water containing 2 mM of CaCl2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... This PCR was performed in 50µL total volume with 2% DMSO using Phusion polymerase and GC buffer (NEB) with an annealing temperature of 52°C and extension time of 30 seconds ...
-
bioRxiv - Immunology 2024Quote: ... Cells were collected and resuspended in 1x glycobuffer-2 along with PNGaseF (100U/106 cells, NEB Cat# P0709S) for 4-8 hrs at 37°C in incubator ...
-
bioRxiv - Genomics 2024Quote: ... and 3.2 µl of PCR mix (1.5× Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs), 0.15% Tween-20 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... as follows: 20 μL reactions were prepared using 2 μL 10x T4 DNA Ligase Reaction Buffer (NEB #B0202S), nuclease-free water ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μg of a construct encoding eGFP-nanos3’UTR was digested using NotI-HF (New England BioLabs, R3189S) for 1 h ...
-
bioRxiv - Genomics 2021Quote: ... End fill-in and A-tailing were performed by addition of Klenow Fragment 3’ --> 5’ exo-(Enzymatics) and dNTP mix (10 mM dATP, 1 mM dCTP, 1 mM dGTP New England Biolabs). After ligation to methylated Illumina TruSeq LT v2 adaptors using T4 DNA Ligase rapid (Enzymatics) ...
-
bioRxiv - Biochemistry 2021Quote: ... were 3′ end-radiolabeled by incubation for 1 hr at 16°C with 1.11 MBq [5′-32P] cytidine-3′,5-bisphosphate (222 TBq mmol−1, Hartmann Analytic) and 10 units T4 RNA ligase 1 (NEB) in a total reaction volume of 20 µl containing 15% (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...
-
bioRxiv - Genomics 2021Quote: ... 1 μl of RNAse inhibitor and 3 μl of Antarctic phosphatase (New England BioLabs Inc.). We then performed a kinase treatment adding 4 μl of T4 Polynucleotide Kinase (PNK ...
-
bioRxiv - Genomics 2021Quote: ... The 3′ adapter (sequence: AGATCG-GAAGAGCACACGTCTGAACTC) was ligated using T4 RNA Ligase 1 (NEB, M0204L) and purified nascent RNA using streptavidin beads (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... and NEBNext Multiplex Oligos for Illumina Index Primers Set 1 and 3 (NEB E7335S, E7710S) and PCR-amplified for 15 cycles ...
-
bioRxiv - Biochemistry 2024Quote: ... In short 5’-phosphorylated and 3’-OH RNA was circularized with RNA ligase 1 (NEB) followed by denaturing PAGE purification as described above ...
-
bioRxiv - Genomics 2022Quote: To digest linear DNA 1 μg of DNA sample was incubated in 50 μl with 1× NEBuffer 4 (NEB), 1mM ATP (NEB ...
-
bioRxiv - Genetics 2024Quote: ... Analysis was done either by amplifying bi-sulfite treated DNA with the Q5U-HotStartHighFidelity Polymerase (NEB) and then analyzing it on a 3% agarose gel or by cloning amplified bi-sulfite treated DNA fragments into the Invitrogen™ Zero Blunt™ TOPO™ PCR Cloning Kit for Sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Molecular Biology 2020Quote: ... was linked to the free hydroxyl group at the 3’-end of transcripts (1 □g of total RNA) by T4 RNA ligase 1 (NEB M0204) in the presence of 15% (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... purified and ligated for 2 h at room temperature using the Instant Sticky-end Ligase Master Mix (NEB, Australia) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 RNA levels were quantified using the Luna Universal Probe Onestep RT-qPCR kit (New England Biolabs) and US CDC real-time RT-PCR primer/probe sets for 2019-nCoV_N1 ...
-
bioRxiv - Genetics 2021Quote: Cells from each fin sample obtained as described before were washed in 2 ml PBS supplemented with 0.1% bovine serum albumin (BSA) (NEB). Each sample was divided into two replicate tubes ...
-
bioRxiv - Microbiology 2020Quote: ... These gBlocks fragments and a NdeI-HindIII-digested pET21b backbone were assembled using a 2× Gibson master mix (NEB). Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and then a final extension at 72°C for 2 minutes using Q5 High-Fidelity Polymerase (New England BioLabs). We conducted a nested PCR to sequence exon 2 (204bp ...
-
bioRxiv - Biophysics 2022Quote: ... both were mixed (∼5μM acceptor strand and ∼2 μM phosphorylated donor strand in a final volume of 19μl) in T4 RNA ligation buffer (New England BioLabs) supplemented with 1mM ATP (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... and permeabilized for 5 min on ice in PBS containing 0.5%Triton X-100 and 2 mM Ribonucleoside Vanadyl complex (New England Biolabs). Coverslips were preserved in 70% EtOH at -20°C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 1.5 mg of protein was cleaved in a 2 ml reaction with 240 Units of TEV protease (NEB) for two hours at 30 °C ...
-
bioRxiv - Genetics 2021Quote: ... 53.5 μl of cut 3C library was mixed with 6.5 μl NEBNext FFPE Repair Buffer and 2 μl NEBNext FFPE Repair Mix (New England Biolabs), followed by incubation at 20°C for 15 minutes and addition of 3 volumes of AMPure XP beads for purification.