Labshake search
Citations for New England Biolabs :
1101 - 1150 of 6189 citations for 1 3 Bis 2 4 hydroxyphenyl 2 propyl benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... were prepared using the Q5 Hot Start High-Fidelity 2 × Master Mix (Cat# M0494L, NEB) as follows ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was coated with 25 µL/well of 2 µg/µL streptavidin (New England Biolabs; N7021S) diluted in 1x HBS and incubated overnight at 4 °C ...
-
bioRxiv - Bioengineering 2024Quote: ... A molecular weight ladder was prepared using 2 µL of ssRNA ladder (New England Biolabs), 8 µL of RNase-free water (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... The fragments were ligated into the pLSV101 vector (1:1 and 3:1 molar ratios) with T4 DNA ligase (New England Biolabs) (10 °C for 30 s and 30 °C for 30 s alternating overnight) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Library preparation for sRNA from sperm samples was done using the New England BioLabs kit NEBNext® Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 (NEB #E7300 and NEB #E7580). The provided guidelines of NEB were followed for small sample preparation until step 15 ...
-
bioRxiv - Cell Biology 2023Quote: ... the pTRE-BI vector was linearized with BamHI and NheI (New England Biolabs) and inserts were integrated by GBA ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 µl freshly made 1 M NH4HCO3 and calf intestinal alkaline phosphatase (1 U, New England Biolabs) were added ...
-
bioRxiv - Molecular Biology 2024Quote: ... Antibodies: Rabbit anti-Yap1 (Cat# 14074S; 1:300) and Rabbit anti-Smad2/3 (NEB #8685S; 1:300).
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Genetics 2023Quote: ... We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles, Tm 62 °C). We finally added dual indexing primers using the i5 and i7 system from Illumina (NEB Q5 for 20 cycles ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mM UTP and 1 mM GTP and 4 mM ARCA (Anti-Reverse Cap Analog) (NEB)) ...
-
bioRxiv - Biophysics 2021Quote: ... the SNAP-tag fragment was digested from the pSNAP-tag (T7)-2 vector (New England Biolabs), inserted into pET-28b plasmid resulting in a construct referred as pET-SNAP ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2) the insert and pcDNA5-FRT-TO were digested with 40U of EcoRV-HF (NEB) and 40U of XhoI (NEB).
-
bioRxiv - Cell Biology 2020Quote: ... peak fractions pooled and reacted with 2-molar excess SNAP-substrate Alexa-488 dye (S9129, NEB) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nuclei were harvested and resuspended in 0.5ml cold 1.2x NEB Buffer 2 (New England Biolabs), incubated with 0.3% SDS for 1 hr at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl 2X Quick T4 ligase buffer and 2 μl Quick T4 DNA ligase (NEB, M2200L) were added to the reaction and incubate at 37 °C for overnight ...
-
bioRxiv - Genomics 2020Quote: ... 66U/μl truncated T4 ligase 2 and 13U/μl murine RNAse inhibitor (all from NEB, USA)) were added to the aRNA/adapter solution ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 µl of PCR product was then mixed with 1.5 µl 10X NEBuffer 2 (B7002S, NEB) and 1.5 µl of Nuclease-free water ...
-
bioRxiv - Biochemistry 2021Quote: ... This was added to 5 ml (per 2 L of culture) amylose resin (New England Biolabs) equilibrated in lysis buffer and left on a tube roller shaker at 4 °C for 1 h ...
-
bioRxiv - Plant Biology 2021Quote: ... using BamHI and XhoI restriction sites and 2× Gibson Assembly master mix (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... a sequencing library was constructed with the NEBNext ARTIC SARS-CoV-2 FS kit (NEB E7658S). For each viral variant ...
-
CRISPR-Cas9-mediated knockout of CYP79D1 and CYP79D2 in cassava attenuates toxic cyanogen productionbioRxiv - Plant Biology 2021Quote: ... 2 µL of cDNA mix was added to 50 µL Phusion High-Fidelity DNA Polymerase (NEB) reaction mix ...
-
bioRxiv - Immunology 2021Quote: ... and SARS-CoV-2 RBD were conjugated to SNAP-Capture Pull-Down resin (New England BioLabs). For each conjugation ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of random primer mix 60 µM (cat. n° S1330S, NEB, New England Biolabs, USA) and 4.8 µL of nuclease-free water ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of random primer mix 60 µM (cat. n° S1330S, NEB, New England Biolabs, USA) and 4.8 µL of nuclease-free water ...
-
bioRxiv - Cancer Biology 2020Quote: ... The pulse step was performed with 2 µM SNAP-cell TMR Star (New England Biolabs, S9105S) for 15 min followed by two washes with medium ...
-
bioRxiv - Cell Biology 2022Quote: ... after which 2 µL of Recombinant PNGaseF (Glycerol-free) (New England Biolabs, Ipswich, MA; catalog # P0709L) was added to each sample ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR was performed with Q5 Hot Start High-Fidelity 2 × Master Mix (#M0494L, New England Biolabs) with the amount of input genomic DNA (gDNA ...
-
bioRxiv - Genetics 2020Quote: ... 10 μL re-annealed PCR product was digested with 2 units T7 Endonuclease I (NEB #M0302L) in NEBuffer 2 for 60 min at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... PCR reaction was performed using OneTaq® 2× Master Mix with Standard Buffer (New England Biolabs). Primers sequences ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then inserted into pU6-2-gRNA plasmids using T4 DNA ligase (New England Biolabs # M0202S).
-
bioRxiv - Molecular Biology 2021Quote: ... Long (HMSpAa) and short (HMSpBb) splinkerette adaptors were first resuspended with 5X NEBuffer 2 (NEB, B7002) to reach a concentration of 50uM ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl 10 mM MnCl2 buffer and 0 or 2 μl lambda phosphatase (NEB #P0753S, USA) in 38 μl supernatant ...
-
bioRxiv - Genomics 2023Quote: ... an aliquot of approximately 10 μg of RNA was treated with 2 units of DNase (NEB) in a final volume of 100 μL for 10 min at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... the pMIR319C containing pMW#2 reporter constructs were linearized with XhoI (R0146, New England Biolabs, USA) and integrated into the mutant HIS3 locus of the YM4271 host strain (Gift from Ram Yadav ...
-
bioRxiv - Microbiology 2023Quote: ... mmpL10 and papA3 and the flanking intergenic sequence was amplified using Q5 HiFi 2× MasterMix (NEB) from genomic DNA isolated from M ...
-
bioRxiv - Cancer Biology 2023Quote: ... the samples were end-repaired by adding 2 μl NEBNext FFPE DNA Repair Mix (NEB, M6630) and 3 μl NEBNext Ultra II End Prep Enzyme Mix (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... for 2 hours at 37°C in 1X T4 PNK buffer (New England Biolabs, cat#B0201S). Radioactively labeled tRNAs were produced by T7 in vitro transcription in the presence of [α-32P]-UTP (PerkinElmer ...
-
bioRxiv - Genomics 2022Quote: ... cells were digested for 2 hours at 37°C using 375U of MboI (NEB, Cat. #R0147). After biotin filling ...
-
bioRxiv - Molecular Biology 2024Quote: ... Ligation was performed in 25% PEG 8000 (61) by T4 RNA Ligase 2 Truncated K227Q (NEB) for 8 h at 16°C ...
-
bioRxiv - Genomics 2024Quote: ... 2.) Size fractionation was performed using the NEBNext Ultra II FS DNA module (New England Biolabs), 3. ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were placed on ice for 2 minutes before adding 250 µL SOC medium (Biolabs #B9020S). The transformed cells in medium were incubated in a shaker for 1 hour at 37°C and 225 RPM ...
-
bioRxiv - Systems Biology 2023Quote: ... 400 µL of RNAlater and 2 µL of 20 mg/mL BSA (New England Biolabs # B9000S) were added to the samples and incubated on ice for 5 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: crRNA (Supplementary Table 2) was synthesized using a HiScribe T7 High Yield RNA Synthesis Kit (NEB). The DNA sequences includes the T7 promoter at the 5’ end and the sequence from crRNA with the target sequence at the 3’ end ...
-
bioRxiv - Cancer Biology 2023Quote: ... and preadenylated linkers were ligated to the RNA fragments using T4 RNA Ligase 2 K277Q (NEB). After 5’ deadenlyase and RecJ exonuclase treatment ...
-
bioRxiv - Molecular Biology 2023Quote: ... the enzymatic activity of the commerically availablale recombinant vaccinia virus methyltransferase mRNA 2’O-methyltransferase (NEB), abbreviated hereagter as VMTR1 ...
-
bioRxiv - Biochemistry 2023Quote: ... Riboswitch samples were prepared by splinted ligation using T4 RNA ligase 2 (New England Biolabs M0239S). 5 nanomoles each of the 5’ and 3’ segments of the riboswitch and the DNA splint were combined and heated to 90 °C for 2 minutes and then allowed to cool to RT over 10 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... Chromosomal and plasmidic DNA was removed by treatment with 2 units of DNase1 (New England Biolabs) for 2 hours at 37°C ...