Labshake search
Citations for New England Biolabs :
1251 - 1300 of 2995 citations for 7H Pyrrolo 2 3 b pyridine 3 7 dimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The upstream and downstream PCR products were designed to have an overlapping region of sequence to promote 3-part Gibson assembly (NEB Gibson assembly kit) and primers 5b and 4 had extensions to anneal to vector pMP62 ...
-
bioRxiv - Molecular Biology 2023Quote: All PolD mutants (Supplementary table 3) were generated using pLB047 and a Q5 Site-Directed mutagenesis kit (E0554 New England Biolabs Inc., Ipswich MA) as described by the manufacturer ...
-
bioRxiv - Genomics 2023Quote: ... This 17 µl of DNA solution was incubated with 3 µl digestion mixture containing 1 µl BciVI (New England Biolabs, cat. no. R0596S) and 2 µl CutSmart buffer (New England Biolabs ...
-
bioRxiv - Physiology 2024Quote: ... and PCR was performed with Flag F (caaggacgacgatgacaaagtc) + 3’OUTR (CAGAGCCAACAACGTGAGGT) primers using Q5® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) according to the manufacturer’s protocol ...
-
Chromosome-level assembly of Cucumis sativus cv. ‘Tokiwa’ as a reference genome of Japanese cucumberbioRxiv - Genomics 2024Quote: ... we put 3 μg of the size-selected DNA for end-repair using NEBNext FFPE DNA Repair Mix (NEW INGLAND BioLabs inc., Massachusetts, USA) and NEBNext Ultra II End Repair/dA-Tailing Module ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was synthesized from a DNA template (Supplementary Table 3) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA, USA) and treated with DNase I (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP mRNA was produced in-house using the Hiscribe® T7 Quick high yield RNA synthesis kit and 3’-O-me-m7G cap analog (New England Biolabs, MA, USA) following the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... each containing 50 ng of DNA (comprising both vector and insert at a 1:3 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was incubated at 16°C overnight and column-purified with molecular biology-grade water ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 µL Ultra II End-prep reaction buffer (NEB, E7647A), 3 µL Ultra II End-prep enzyme mix (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cell extracts (average OD 7) were treated with MNase (NEB), CaCl2 (5mM final concentration) ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... PCR protocols entailed an initial phase of 95° C for 3 min using Hot Start Taq polymerase (New England BioLabs Inc., Ipswich, MA, USA), followed by 35 cycles at 50°C and 52°C annealing temperatures for 16S and ITS amplicons respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries were generated from a total amount of 3 μg RNA per sample using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... 500 μl of lysed cells were transferred to a tube containing 4.5 ml of digestion mix (1X NEB 3 buffer, 1% triton X-100) and 100 μl of the lysed cells were transferred to a tube containing 0.9 ml of digestion mix ...
-
bioRxiv - Genomics 2024Quote: ... Samples were then rinsed with 2X SSC before incubating with a blocking buffer (10% BSA, 3% v/v 6% v/v murine RNase inhibitor [NEB, M0314L] in 2X SSC) for 30 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... 5’-GCT GCG TTC TTC ATC GAT GC-3’) were chosen with barcodes for PCR amplification using Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA, USA). The PCR products were then mixed at equal density ratios and purified with a Gel extraction kit (QIAGEN ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 100 ng of DNA was cleaved with PstI HF and MseI restrictases in CutSmart® buffer (New England Biolabs; 3 hours at 37°C). P1 and P2 barcoded adapters corresponding to the restriction site of the enzymes were ligated immediately afterwards with T4 ligase (NEB ...
-
bioRxiv - Genomics 2022Quote: ... and for the synthesis of the second strand of cDNA was used the Klenow fragment 3’-5’ exo (New England Biolabs Inc., Ipswich, MA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µL 10x T4 ligase buffer, 3 µL 50 mg/mL BSA, 1.5 µL 2000U/µL T4 ligase, NEB, 6 µL BLISS adapter pairs). For removal of excess adapters ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were resuspended in 50 mL buffer 3 (20mM KPi pH 7.4, 1.2M Sorbitol, 10 mM ribonucleoside vanadyl complex (NEB S1402S, pre-warmed at 65 °C), 0.08mg/ml Zymolyase-20T (Amsbio 326921) ...
-
bioRxiv - Biochemistry 2021Quote: ... 125 to 75 U/ 5 μg RNase B (Cat.P7817S, NEB) and fetuin (Cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cas9 protein (IDT) was suspended with a Diluent B (NEB) to make 1 μM solution ...
-
bioRxiv - Genetics 2019Quote: ... in 7 ml of ligation cocktail including 1.1 × ligation buffer (NEB) and 10% Triton X-100 for 2 hours at 16°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 units USER Enzyme for 30 minutes at 37°C (NEB)51 ...
-
bioRxiv - Genomics 2021Quote: ... 7 μL 20 μg/μL proteinase K (New England Biolabs P8107) was added ...
-
bioRxiv - Systems Biology 2024Quote: ... 7 μL of NEBNext Ultra II End Prep Enzyme buffer (NEB) and 3 μL of NEBNext Ultra II End Prep Enzyme Mix (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were washed once with PBS for 3 minutes and subjected to nuclear staining with Hoechst (New England BioLabs; 4082S; diluted 1:5000 in PBS) for 5 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were washed once with PBS for 3 minutes and subjected to nuclear staining with Hoechst (New England BioLabs; 4082S; diluted 1:5000 in PBS) for 5 minutes ...
-
bioRxiv - Genomics 2021Quote: ... The selected DNA fragments were end-repaired and 3’-adenylated with the NEBNext® Ultra™ II End Repair/dA-Tailing Module (New England Biolabs, Ipswich, MA, USA). The DNA was then purified with AMPure XP beads (Beckmann Coulter ...
-
bioRxiv - Biochemistry 2022Quote: ... RNase B from bovine pancreas (New England Biolabs, Ipswich MA, USA), and horse radish peroxidase (HRP ...
-
bioRxiv - Microbiology 2024Quote: ... coli B strain was dephosphorylated with 0.4 U/µL QuickCIP (NEB) in 1 x rCutSmart buffer (NEB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the PURExpress® kit containing Solution A and Solution B (NEB) was used to prepare the transcription-translation reaction ...
-
bioRxiv - Microbiology 2024Quote: ... (b) Heat labile Shrimp Alkaline Phosphatase (rSAP) (1 µl) (NEB #M0371S) was used to remove terminal phosphates that could interfere with terminal extension by incubating in rCutSmart buffer (3.5 µl ...
-
bioRxiv - Microbiology 2020Quote: ... including equimolar amounts of dGTP and 7-deaza-GTP (New England Biolabs), at a concentration of 200 µM was used (Maertzdorf et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The solution was diluted by adding 7 ml of ligation buffer (NEB) containing 1% Triton X-100 and 30 Units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2022Quote: ... rk430-mScarlet-SNAP (7 μM monomer) was incubated with benzylguanine-biotin (NEB) in a 4 to 1 molar ratio at room temperature for 15 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 μg pNZdmsC3GH plasmid was digested with 40 U of SfiI (NEB), separated on a 1% agarose gel and ...
-
bioRxiv - Microbiology 2022Quote: ... for 7-12 h at 37°C in CutSmart buffer (NEB, B7204S). Digested products were then visualised on a 4% NuSieve (Lonza ...
-
bioRxiv - Biochemistry 2022Quote: ... purified KRAS protein was mixed with GMP-PNP (molar ratio of 10:1 GMP-PNP:KRAS) and calf intestinal alkaline phosphatase (NEB cat# M0290, 3 units per mg of KRAS). The reaction mixture was incubated for 3 hours at room temperature and then purified by size-exclusion chromatography on a 10/300 Superdex 75 GL column (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... The samples were transferred to 7 ml of 1.15x T4 ligation buffer (NEB), incubated with 1% Triton X-100 for 1 hour at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μL GlycoBuffer 2 10X (NEB), 2 μL NP-40 ...
-
bioRxiv - Genetics 2019Quote: ... The ligation reaction mixture B consisted of appropriate amount of T3 ligase (NEB) with ligation buffer ...
-
bioRxiv - Cancer Biology 2019Quote: Purified hTERT_191-306 proteins were incubated with CDK1-cyclin B (New England Biolabs) or purified IKK2_2-664 proteins ...
-
bioRxiv - Cell Biology 2022Quote: ... B and C oligonucleotides were phosphorylated with T4 polynucleotide kinase (NEB, Cat #M0201L) according to the manufacturer recommendations ...
-
bioRxiv - Genomics 2022Quote: ... A restriction digestion mix containing 7 µl of 10X NEB CutSmart Buffer (NEB #B7204), 4.5 µl of NlaIII (NEB #R0125) ...
-
bioRxiv - Cell Biology 2023Quote: ... The pet30-B vector was digested with Nde1 (R0111, New England BioLabs, Waltham, MA) and EcoRI-HF (R3101 New England BioLabs ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL of 2% SDS and 2 μL of proteinase K (New England Biolabs) were added and the solution was incubated at 37°C for 1 hour before purification with the Qiagen DNA clean up kit ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μl 10X NEBuffer 2 (New England Biolabs) and nuclease-free water (total of 20 μl ...