Labshake search
Citations for New England Biolabs :
1151 - 1200 of 2799 citations for 7H Pyrrolo 2 3 b pyridine 3 7 dimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... 3 ng of DNA was used for library preparation according to NEBNext® Ultra™ II DNA Library Prep Kit (NEB, E7645S). Purity and size distribution was analyzed on Fragment Analyzer ...
-
bioRxiv - Biophysics 2021Quote: ... was annealed with primer P3 (100 bp long) at a 1:3 DNA to primer molar ratio and ligated using T4 DNA ligase (NEB, catalog #M0202S). Primer P3 had biotin modification at its 3’ end ...
-
bioRxiv - Molecular Biology 2022Quote: ... deglycosylation treatment (Dglyco) consisted of sample incubation for 3 hours at 37°C with 20 nL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per μL of sample ...
-
bioRxiv - Genomics 2022Quote: ... RNA samples were then processed through the following steps: (i) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204), (ii ...
-
bioRxiv - Genetics 2022Quote: ... the homology 5’arm and 3’arm was amplified and linked to the pBS backbone with Gibson Assembly Kit (NEB, cat. no.E2611L) as ‘pBS-CG32814-arm’ ...
-
bioRxiv - Plant Biology 2022Quote: ... The doubly digested vectors were assembled with a single fragment containing the ORF containing 5′ and 3′ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... RNAs (either from ribosome footprints or fragmented RNAs from total cytoplasmic RNAs) were dephosphorylated at their 3’ end using PNK (New England Biolabs, Cat: M0201) in the following buffer ...
-
bioRxiv - Microbiology 2022Quote: ... A repair template plasmid carrying the ~1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard NATR cassette inserted between the two flanks ...
-
bioRxiv - Systems Biology 2022Quote: ... The libraries were then run on a 3% agarose gel and the product was extracted using NEB Monarch DNA Gel Extraction Kit (NEB, Cat# T1020L). Next ...
-
bioRxiv - Immunology 2023Quote: ... using primers that overlapped with pLenti-EF1-Blast at the xho1 site on the 5’ end and overlapped with the 5’-end of the RNase L coding sequence on the 3’-end (Supplementary table 1) and NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs: M0541S). RNase L coding sequence was amplified using a 3’-end primer that overlapped with pLenti-EF1-Blast at the xba1 site ...
-
bioRxiv - Microbiology 2023Quote: ... DNA end was repaired and addition of adenosine at the 3’ end of the DNA was performed with NEBNext Ultra II End Repair/dA-Tailing Module (New England Biolabs, Cat# E7546). A linker was ligated to the ends of DNA using the NEBNext Ultra II Ligation Module (New England Biolabs ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was A-tailed with Fermentas Klenow 3′ to 5′ exonuclease (Cat# EP0421) and ligated with adaptor oligonucleotides (NEB NEXT adaptor oligos) using Mighty Mix Ligase (Cat# TAK6023) ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA not ligated to U2 oligo and therefore not protected by 3’ C3 Spacer was removed by addition of exonucleases I and III (NEB, Ipswich, USA). The enriched products were purified and then subjected to enzymatic methylation conversion according to the manual of NEBNext Enzymatic Methyl-seq Conversion Module (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... The purified shESR1 and SGEN DNA were digested with XhoI and EcoRI and subsequently ligated at a molar ratio of approximately 3:1 with 10X T4 DNA Ligase Buffer (New England BioLabs Inc. #B0202S) and T4 DNA Ligase (New England BioLabs Inc ...
-
bioRxiv - Developmental Biology 2023Quote: ... the 3′ ends of small RNA were ligated to an adapter using T4 truncated RNA ligase (Lucigen, Cat# LR2D11310K and NEB, Cat# M0242L), followed by the ligation of the 5′-end adaptors by T4 ligase ...
-
bioRxiv - Molecular Biology 2024Quote: ... About 3 µg of DNA from each sample was digested with two restriction enzymes (PstI; NEB catalog #R0140 and XhoI; NEB catalog #R0146). The digested genomic DNA was resolved on a 1% ...
-
bioRxiv - Microbiology 2024Quote: ... A repair template plasmid carrying the ∼1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard HYGR cassette inserted between the two flanks ...
-
bioRxiv - Genomics 2024Quote: ... Small RNA sequencing libraries were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina following the manufacturer’s recommendations with the 3’ ligation step changed to 16°C for 18 hours to improve capture of methylated small RNAs (New England Biolabs, cat# E7300S). Small RNA PCR amplicons were size selected on 10% polyacrylamide non-denaturing gels ...
-
bioRxiv - Immunology 2024Quote: ... cDNA for 3’ RACE was generated using RNA from IFN-β treated A549 cells using the Template Switch RT Enzyme Mix (NEB, #M0466) and anchored primers ...
-
bioRxiv - Microbiology 2020Quote: ... B are ligated first by T4 DNA ligase (NEB) in 40μl system ...
-
bioRxiv - Systems Biology 2022Quote: ... 5’-AAAC(N)19-20-3’) by combining 1 μl of each 100 μM oligonucleotide with 1 μl of 10× T4 ligation buffer (NEB cat. no. B0202S), 6.5 μl of water ...
-
bioRxiv - Genomics 2022Quote: ... and then ‘A’ base was added to 3’ blunt ends using the A-Tailing reaction (NEBNext® UltraTM II End Repair/dA-Tailing Module, NEB, Cat. E7546). The purified A-tailed DNA was ligated with adaptors from the Ligation Sequencing Kit (SQK-LSK109 ...
-
bioRxiv - Genomics 2019Quote: ... 3 μg RNA was used to generate sequencing library by using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA). PCR was carried out using Phusion High-Fidelity DNA polymerase ...
-
bioRxiv - Neuroscience 2019Quote: ... The cassette was amplified by PCR then ligated to the donor template using Gibson Assembly Master Mix (NEB, primers in Supplementary Table 3). The reaction was incubated at 50 °C for 15 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... a non-adenylated 3’ adapter was ordered for chemical synthesis from IDT™ and adenylated with the 5’ DNA Adenylation Kit (New England Biolabs® Inc.) (see Supplemental Table 4 for primers and adapters used) ...
-
bioRxiv - Cell Biology 2022Quote: Living ovaries were incubated at room temperature in SNAP solution containing 3 μM SNAP- Cell TMR-Star or SNAP-Cell 647SiR (New England BioLabs, S9105S and S9102S), 10% FCS and 0,2 mg/ml Insulin in Schneider’s medium ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Neuroscience 2019Quote: ... We designed custom adaptors (Table S5) which were directly ligated to the 3’ ends of RNA using RNA ligase 1 (NEB Cat. No. M0437) and truncated RNA ligase KQ (NEB M0373) ...
-
bioRxiv - Zoology 2021Quote: ... a total of nine RNA libraries were prepared with 3 μg RNA using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection of editing in the EBE region of CsLOB1 promoter was performed by amplifying the target region (primers in Supplementary Table 3) with high fidelity DNA polymerase Q5 (New England Biolabs, Ipswich, MA, USA), followed by cloning of PCR products and sequencing.
-
bioRxiv - Microbiology 2022Quote: ... We then used 1:3 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). After the HiFi assembly ...
-
bioRxiv - Molecular Biology 2023Quote: ... digoxigenin-11-ddUTP was added to the 3’ end of the digested fragments using terminal transferase enzyme (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Microbiology 2023Quote: ... The upstream and downstream PCR products were designed to have an overlapping region of sequence to promote 3-part Gibson assembly (NEB Gibson assembly kit) and primers 5b and 4 had extensions to anneal to vector pMP62 ...
-
bioRxiv - Molecular Biology 2023Quote: All PolD mutants (Supplementary table 3) were generated using pLB047 and a Q5 Site-Directed mutagenesis kit (E0554 New England Biolabs Inc., Ipswich MA) as described by the manufacturer ...
-
bioRxiv - Genomics 2023Quote: ... This 17 µl of DNA solution was incubated with 3 µl digestion mixture containing 1 µl BciVI (New England Biolabs, cat. no. R0596S) and 2 µl CutSmart buffer (New England Biolabs ...
-
bioRxiv - Physiology 2024Quote: ... and PCR was performed with Flag F (caaggacgacgatgacaaagtc) + 3’OUTR (CAGAGCCAACAACGTGAGGT) primers using Q5® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The inserted barcoding sequences were annealed using randomized overlapping single stranded oligonucleotides by adding 3 µl of each oligonucleotide (100 µM) to 500 µl 1x 2.1 NEB-buffer (New England Biolabs, Ipswich, MA, USA, #B6002S) followed by boiling at 100 °C for 3 minutes to finally let them associate during the cooling to room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... hereafter called Flag-SERCA2-C) were constructed from 3×Flag-SERCA2 using a Q5 Site-Directed Mutagenesis Kit (New England BioLabs, Ipswich, MA, USA). mCherry-Sec61B (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... 3 ug RNA was treated with Promega RQ1 DNase (M6101) then cleaned up with the Monarch® RNA Cleanup Kit (NEB Biolabs, T2050S) and eluted in 30 µl dH2O.
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 µL Ultra II End-prep reaction buffer (NEB, E7647A), 3 µL Ultra II End-prep enzyme mix (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cell extracts (average OD 7) were treated with MNase (NEB), CaCl2 (5mM final concentration) ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... PCR protocols entailed an initial phase of 95° C for 3 min using Hot Start Taq polymerase (New England BioLabs Inc., Ipswich, MA, USA), followed by 35 cycles at 50°C and 52°C annealing temperatures for 16S and ITS amplicons respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries were generated from a total amount of 3 μg RNA per sample using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... 500 μl of lysed cells were transferred to a tube containing 4.5 ml of digestion mix (1X NEB 3 buffer, 1% triton X-100) and 100 μl of the lysed cells were transferred to a tube containing 0.9 ml of digestion mix ...
-
bioRxiv - Genomics 2022Quote: ... and for the synthesis of the second strand of cDNA was used the Klenow fragment 3’-5’ exo (New England Biolabs Inc., Ipswich, MA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µL 10x T4 ligase buffer, 3 µL 50 mg/mL BSA, 1.5 µL 2000U/µL T4 ligase, NEB, 6 µL BLISS adapter pairs). For removal of excess adapters ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were resuspended in 50 mL buffer 3 (20mM KPi pH 7.4, 1.2M Sorbitol, 10 mM ribonucleoside vanadyl complex (NEB S1402S, pre-warmed at 65 °C), 0.08mg/ml Zymolyase-20T (Amsbio 326921) ...