Labshake search
Citations for New England Biolabs :
1251 - 1300 of 4533 citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Dephosphorylation of DNA ends was performed by addition of 5 μl rSAP (NEB, #M0203) and incubation at 37°C for 45 min ...
-
bioRxiv - Genomics 2023Quote: ... The 5′ UTR and coding sequence were amplified in Q5 polymerase reactions (NEB, M0491) with 10 ng HsCD00617865 template and 500 nM forward and reverse primers for 25 cycles using manufacturer’s recommendations with 55 °C annealing temperature ...
-
bioRxiv - Microbiology 2024Quote: ... The myc epitope was added before the stop codon of blaSHV-5 by NEB Q5 Site-Directed Mutagenesis according to the manufacturer using primers JCP505/506 with pTOX5 blaSHV-5 template ...
-
bioRxiv - Genomics 2024Quote: ... Ligation products were transformed into either 5-alpha or 10-beta electrocompetent cells (NEB) and grown in liquid LB-Amp cultures ...
-
bioRxiv - Bioengineering 2024Quote: The 5’ RACE protocol using the template-switching reverse transcriptase enzyme mix from NEB was executed following the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5′ end labelled using γ32P UTP (Perking Elmer) and T4 polynucleotide kinase (NEB) following manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... 5 μl of genomic DNA was used with Luna Universal qPCR Master Mix (NEB) and primers for the R ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 5 µl of collection buffer (NEBNext Single Cell Lysis Module, New England Biolabs). Noteworthy ...
-
bioRxiv - Genomics 2023Quote: ... around 5 million cross-linked nuclei were digested overnight using 400 U DpnII (NEB). After digestion ...
-
bioRxiv - Genomics 2023Quote: ... 0.5 uL of 5 x mRNA Second Strand Synthesis buffer (New England Biolabs, E6111L), and 0.25 uL of mRNA Second Strand Synthesis enzyme (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... The DNA/RNA hybrid strand was pre-adenylated with DNA 5’ Adenylation Kit (NEB) and purified with Oligo Clean & Concentrator (Zymo) ...
-
bioRxiv - Biochemistry 2023Quote: ... activation was performed overnight at 4 °C with 5 μg of Factor Xa (NEB) per mg of protein ...
-
bioRxiv - Cancer Biology 2023Quote: ... A volume of 40 μl reaction mix containing 5 μl isothermal amplification buffer (NEB), 3 μl 100 mM MgSO4 ...
-
bioRxiv - Genetics 2023Quote: ... 5% DMSO and 1× NEBNext High-Fidelity PCR master mix (New England BioLabs, M0541L) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Injection mixtures contained 10μl restriction digest including 5 units of I-SceI enzyme (NEB), 1μl CutSmart buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µg of genomic DNA from the clones were digested solely with XhoI (NEB) overnight at 37 °C ...
-
bioRxiv - Immunology 2022Quote: ... cleaned and concentrated 20x using the Monarch PCR & DNA Cleanup Kit (5 µg) (NEB). Further cleanup was done with the E-gel imager system (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... which was purified directly over Monarch DNA Cleanup Columns (5 μg) (New England Biolabs) using a 10:1 ratio of binding buffer (a modified version of Qiagen’s PB buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... 5% (v/v) DMSO and 0.5 U Phusion High-Fidelity DNA polymerase (NEB, M0530S). Cycling was performed using the following thermocycler settings ...
-
bioRxiv - Genetics 2023Quote: ... along with an additional 5 µL 2x Gibson Assembly Master Mix (NEB Cat#E2611L). The reaction mixture was incubated at 50°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... All the produced constructs were propagated in competent cells (5-alpha Competent E.coli; NEB) and isolated by NucleoSpin Plasmid (TaKaRa) ...
-
bioRxiv - Genomics 2023Quote: ... RNAs were 5’dephosporylated through 90 minutes incubation in total with thermostable QuickCIP (NEB) in which the samples were briefly heated to 75°C and quickly chilled on ice at the 60 minutes mark ...
-
bioRxiv - Immunology 2023Quote: ... 5 µg of sequencing verified plasmid were restriction digested using BsmBI V2 (NEB, #R0739S) in a 50 µl reaction with NEB3.1 buffer (NEB ...
-
bioRxiv - Microbiology 2024Quote: 5’ RACE was done using a Template Switching (TS) Reverse Transcriptase Enzyme mix (NEB) that takes advantage of a template switching reverse transcriptase and a template switching oligonucleotide (TSO) ...
-
bioRxiv - Genomics 2024Quote: ... RNAs were 5’dephosporylated through 90 minutes incubation in total with thermostable QuickCIP (NEB) in which the samples were briefly heated to 75°C and quickly chilled on ice at the 60 minutes mark ...
-
bioRxiv - Genetics 2024Quote: ... along with an additional 5 µL 2x Gibson Assembly Master Mix (NEB Cat#E2611L). The reaction mixture was incubated at 50°C for 1 hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli 5-alpha and purified using the Monarch Plasmid Miniprep Kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2024Quote: ... and fragment inserts were cloned into digested pLS21-5 using Gibson assembly (NEB, E5510S). The plasmid pARL01 ...
-
bioRxiv - Neuroscience 2024Quote: ... Each PCR reaction was subsequently supplemented with 5 μL of CutSmart Buffer (NEB B7204) and digested using 1μL DpnI restriction enzyme (NEB R0176 ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.5 uL of 5 x mRNA Second Strand Synthesis buffer (New England Biolabs, E6111L), and 0.25 uL of mRNA Second Strand Synthesis enzyme (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... with 5 μL Quick-Load pBR322 DNA-MspI Molecular Marker (New England Biolabs Inc.) in a separate lane ...
-
bioRxiv - Biochemistry 2024Quote: ... The assembly reaction was transformed into NEB 5-alpha competent cells (New England Biolabs). After the recovery step ...
-
bioRxiv - Molecular Biology 2024Quote: ... Coverslips were then washed twice for 5 min in 1x rCutSmart buffer (NEB; #B6004S) and once in 1x blunting buffer (NEB ...
-
bioRxiv - Genetics 2024Quote: ... Dangling ends were removed by a 5 min incubation with Exonuclease III (NEB #0206) at 37 °C and biotin enrichment was done using 20 ul DynabeadsTM MyOneTM Streptavidin C1 beads (Invitrogen #65001) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Constructed plasmids were transformed and maintained in NEB 5-alpha (New England Biolabs (NEB) C2987H ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Constructed plasmids were transformed and maintained in NEB 5-alpha (New England Biolabs (NEB) C2987H ...
-
bioRxiv - Cell Biology 2024Quote: ... 5-10 μg of plasmid was linearised with the restriction enzyme NotI (NEB, R3189L). The linearised plasmids were run on a gel to ensure complete digestion ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Transformations used the NEB recommended protocols for chemical transformation (NEB 5-alpha, Cat# C2987H) or electroporation (NEB 10-beta ...
-
bioRxiv - Plant Biology 2024Quote: ... for 30 minutes and the supernatant mixed with 5 mL Chitin Resin (NEB #S6651), previously washed first with 30 mL of ddH2O and then 20 mL of HEGX buffer ...
-
bioRxiv - Genomics 2024Quote: ... we added 5 pg of unmethylated DNA from phage λ (New England Biolabs, E7123A) per 10 ng sample DNA ...
-
bioRxiv - Bioengineering 2024Quote: ... digested vec-tors were treated with 5 units of Antarctic Phosphatase (New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Biophysics 2024Quote: ... The purified plasmid DNA (5 µg) was incubated with T4 DNA ligase (NEB, M0202) (2.5 µL ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL NEB T4 DNA Ligase from the NEB Quick Ligation Module (NEB, E6056), and 1.0 μL Native Adapter (NA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We then immediately added 5 µL of a solution with 1X Ligase Buffer (NEB), 0.75 mM ATP (NEB) ...
-
bioRxiv - Biochemistry 2024Quote: ... N-glycanase treatment was performed by dissolving the samples in 50 mM Tris-HCl (pH 8.0) and 10 nM ethylenediaminetetraacetic acid (EDTA) containing 3 units/μL PNGaseF (New England BioLabs, Inc. MA, USA) and incubated for 4 h at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was ligated to the 3′ adaptor tRNA using T4 RNA ligase 2 (NEB, M0351L) for 2 h at 37°C ...