Labshake search
Citations for New England Biolabs :
1251 - 1300 of 4949 citations for 4 Chloro 6 fluorobenzene 1 3 diamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... A single adenine base was added to fragment ends by Klenow fragment (3′ to 5′ exo minus; NEB), followed by ligation of Illumina adaptors (Quick ligase ...
-
bioRxiv - Microbiology 2024Quote: ... 1.25 µL native ligation barcode (ONT SQK-NBD114-96) and 3 µL Blunt/TA Ligase Master Mix (NEB). The reaction was mixed by pipetting ...
-
bioRxiv - Genomics 2023Quote: ... CBS 112042+ and CBS 124.78+ were sequenced on R9.4.1 flowcells using the LSK108 kit with 3 μg DNA as input for the end prep reaction (NEB ULTRA-II EP ...
-
bioRxiv - Genomics 2023Quote: ... with the ligation of 3′-small RNA Tru-Seq adapter using the truncated T4 RNA Ligase 2 (NEB). 45-150 nt capped small RNAs were recovered on 15% Urea-TBE gel (Novex ...
-
bioRxiv - Genomics 2024Quote: ... 3.) Library preparation was performed using the NEBNext Ultra II library preparation kit for Illumina (New England Biolabs) and 4. ...
-
bioRxiv - Cell Biology 2023Quote: Ifnb1 mRNA 3’ UTR (NM_002176.4) was synthesized using the HiScribe T7 High Yield RNA synthesis kit (NEB, E2040S) through in vitro transcription ...
-
bioRxiv - Biochemistry 2022Quote: Ligation workups from the previous step were supplemented with 3 μL of 6X purple gel loading dye (NEB), heat denatured at 85 °C for 1 min ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Microbiology 2022Quote: ... Either 3-5 µL of Color Prestained Protein Standard-Broad Range (11-245 kDa) (New England Biolabs, P7712) or 1-3 µL of PageRuler Prestained Protein Ladder (10-180 kDa ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was resuspended in 5 μl of water and the 3′ ends dephosphorylated with PNK (New England BioLabs) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the previously constructed genome-integrating vector pCS75 (25) (Supplementary Table 3) was cleaved with PmeI and EagI (NEB), the resulting fragments were separated on a 0.8% agarose gel ...
-
bioRxiv - Microbiology 2023Quote: Purified vigR 3’ UTR amplified from JKD6008 was in vitro transcribed (IVT) using HiScribe T7 RNA polymerase (NEB). RNA products were DNase I treated (NEB ...
-
bioRxiv - Neuroscience 2024Quote: After washed with 0.1 3 SSC buffer (Thermo, AM9770) supplemented with 0.05 U/ml RNase inhibitor (NEB, M0314L), tissue sections placed on the chip were permeabilized using 0.1% pepsin (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... using ETAA1 DBR R1 RT-PCR primer 5′-AAGTTCTTCTTCTTGACTTTGTGTT-3′ and treated with RNaseH (New England Biolabs, M0297S). 1μl of the cDNA was used for PCR amplification reactions using using GoTaq® G2 DNA Polymerase (Promega ...
-
bioRxiv - Microbiology 2024Quote: ... 3 μL of a ligation mixture containing 0.01 U of Bst 2.0 DNA polymerase (NEB, Ipswich, MA, USA), 0.5 U of SplintR ligase (NEB ...
-
bioRxiv - Genomics 2024Quote: ... followed by 5’ end phosphorylation of cleaved target RNAs with T4 polynucleotide kinase (PNK, 3’ -phosphatase minus, NEB)) ...
-
bioRxiv - Microbiology 2024Quote: ... This plasmid was digested using XbaI and BstXI (5’ tag) or HindIII and SpeI (3’ tag) enzymes (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... the fragments were repaired and A-tailed using 15 units of Klenow 3’-5’ exo-(New England Biolabs). After End-repair and A-tailing ...
-
bioRxiv - Genetics 2021Quote: ... The entire alh-6 genomic sequence (ATG to stop) was amplified by PCR and cloned in a linearized pMiniT 2.0 vector (NEB PCR Cloning Kit, Cat. #E1202S). Plasmid DNA was purified using the Zymo Research Zyppy Plasmid Miniprep kit (Cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was initiated by adding 4 μl of 5× ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Biophysics 2020Quote: ... the 5’ end of the 4 kb transcript was biotin-labeled using Vaccinia Capping System (NEB) and 3-biotin-GTP (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... Primers were designed for the replacement of each of the 4 loops using Q5 polymerase (NEB) PCR reaction and a KLD enzyme mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... after ligation overnight at 4°C with the T4 DNA ligase (New England Biolabs, Evry, France).The sequences of the cloned fragments in the resulting plasmids pYES2::MlpCSP1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mM DTT) supplemented with 200 μM cold SAM (S- adenosyl methionine) (NEB; for immunoblotting) or 1 µCi 3H-labelled SAM (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... Donor 4) were combined in a single ligation reaction using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions and incubated overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the extension enzyme was replaced with 4 units of Bst 2.0 Warmstart DNA Polymerase (NEB, Cat.No.M0538). Correspondingly ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR products (∼300 ng) were incubated with 2 μl 10X NEBuffer 4 (New England Biolabs), 1 μl BtsCI restriction enzyme ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos were 5’-end radiolabeled at a final concentration of 4 μM with T4 PNK (NEB) and γ-32P-ATP after incubation for one hour at 37°C followed by enzyme inactivation at 72°C for 10 minutes ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Genomics 2024Quote: ... 4 µg of each sample was reverse transcribed using dT priming with Protoscript II (NEB, M0368L) and subsequently treated with 0.5 µL each of Rnase H and Rnase A (Thermo Fisher ...
-
bioRxiv - Genetics 2024Quote: ... Plugs were then equilibrated in NEBuffer 4 and treated with 75 U of exonuclease T (NEB) for 90 min at 24 °C.
-
bioRxiv - Biochemistry 2024Quote: ... Alkaline phosphatase treatment was performed over night at 4°C using Lambda Protein Phosphatase (#P0753S, BioLabs).
-
bioRxiv - Microbiology 2020Quote: ... and a “bottom” strand with sequence 5’-AAAAC-(30bp spacer reverse complement)-3’ were phosphorylated with PNK (NEB, M0201S) in a 50 μL reaction volume (1.5 μL 100 uM top oligo ...
-
bioRxiv - Microbiology 2020Quote: ... RNA and 3′ adapters were incubated at 22°C for 2.5 hr with 51 U of T4 RNA Ligase I (NEB) and 12 U of recombinant RNase inhibitor (Takara Bio ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ end of the first block and the 3’ end of the last block contained SapI (NEB, R0569) recognition sites instead ...
-
bioRxiv - Genetics 2022Quote: ... Pddx-23::ceDDX23::ddx-23 3’UTR (nEx2971 and nEx2972) was generated by HiFi DNA Assembly (New England Biolabs) of Pddx-23 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Selectively captured polyadenylated RNAs (1μg) were ligated directly to an DNA/RNA hybrid adapter (5’-CTACAC GACGCTrCrUrUrCrCrGrArUrCrUrNrNrN-3’) using T4 RNA ligase (NEB) at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: pCrPV-3 and pCrPV-1A-DcDV-1A were linearized by digestion with BamHI-HF (New England Biolabs, Ipswich, Massachusetts). Wild-type and CrPV-DcDV RNA was prepared by in vitro transcription of 1 µg linearized plasmid using the mMESSAGE mMACHINE T7 transcription kit (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... unc-116::tagRFP::tom7 including unc-54 3’-UTR was PCR amplified using Phusion polymerase (NEB, Ipswich, MA, USA) from unc29p::unc-116::tagRFP::tom7 using following primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Par-3 PDZ1-APM and PDZ1-APMΔPDZ2 were first his-purified (described above) prior to incubation with amylose resin (NEB). Amylose-bound Par-3 was then washed and resuspended in binding buffer as described for GST proteins.
-
bioRxiv - Cell Biology 2020Quote: PCR amplification of short fragments for screening purposes (<3 kbp) was conducted using OneTaq® (New England Bolabs (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2021Quote: ... Construct included 5’ and 3’ complementary overhangs for ligation into pPICZαA using NEBuilder HiFi DNA Assembly (New England Biolabs) to form pPICZαA_GH43_34 ...