Labshake search
Citations for New England Biolabs :
1051 - 1100 of 4949 citations for 4 Chloro 6 fluorobenzene 1 3 diamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... (4) lacI and tac promoter from pMAL-c5X (New England Biolabs, Ipswich, MA). The modified replacement plasmid for pMut2 ...
-
bioRxiv - Physiology 2021Quote: ... Mutations in hSlo1 and β1/4 were introduced by PCR-mediated mutagenesis (NEB) using oligonucleotide primers (IDT ...
-
bioRxiv - Biochemistry 2021Quote: ... 4% Glycerol and 0.1 mM DTT) with 75 µM S-Adenosylmethionine (SAM, NEB), varying amounts ssRNA and duplex RNA (see above) ...
-
bioRxiv - Genomics 2023Quote: ... The DGP-4 fragments were then cloned into the AscI/NheI (NEB, USA) site of the p200 vector to construct the sgRNA library (p200 library ...
-
bioRxiv - Molecular Biology 2022Quote: ... was mixed with 7.1 μl H2O and 0.9 μl NEB 4 buffer (NEB). After incubating for 10 min at 96°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Adapter-ligated DNA was digested with 4 µL of EcoRV-HF (NEB, R3195), incubated at 37 °C for 30 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... The gel fragments were incubated with 4 mg/mL proteinase K (NEB, P8107) in PK buffer (100 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 U/mL creatine kinase) containing 10 µMnt cssDNA (NEB, PhiX virion DNA) was supplemented with Rad51 (5 µM ...
-
bioRxiv - Biophysics 2024Quote: ... the product was digested by Dpn1 for 4 hours (New England Biotechnologies, NEB). The PCR product was purified by gel purification (Zymo Research) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 µl of T4 DNA polymerase (3,000 U/ml, NEB, cat. no. M0203S) and 1 µl of the DNA polymerase I large (Klenow ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 picomoles of hybridized DNA were mixed with USER3 mix (New England Biolabs) in ThermoPol buffer (20 mM Tris-HCl pH 8.8 ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Systems Biology 2021Quote: ... PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6) for 5 cycles at an annealing temperature of 66C followed by 5 cycles with no annealing step (NEB Q5) and then purified with the Monarch PCR kit.
-
bioRxiv - Systems Biology 2021Quote: ... P1 indexing barcodes were added using forward primers P1_inner_A through P1_inner_D and reverse primer P1_inner_nested_rev (Supplementary file 6) for 5 cycles at an annealing temperature of 55C followed by 5 cycles with no annealing step (NEB Q5). PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6 ...
-
bioRxiv - Systems Biology 2021Quote: ... The final enrichment PCR used primers MO588 and MO589 (Supplementary file 6) for 20 cycles at an annealing temperature of 66C (NEB Phusion), followed by purification with the Monarch PCR kit ...
-
bioRxiv - Cancer Biology 2020Quote: ... and gene expression was analyzed by RT-qPCR on QuantStudio 6 (Applied Biosciences) using the Luna Universal qPCR kit (New England Biolabs, M3003). Relative expression was normalized to Actb and Gapdh housekeeping genes and was determined using the ΔΔCt method ...
-
bioRxiv - Genomics 2020Quote: ... and then used as the template for an additional 6 cycles of PCR amplification with NEBNext i5 and i7 primers (NEB #E7600S).
-
bioRxiv - Genomics 2021Quote: NGS libraries were generated by amplifying the CUT&Tag DNA fragments with i5 and i7 barcoded HPLC-grade primers (Buenrostro et al., 2015) (Supplementary Table 6) with NEBNext® HiFi 2x PCR Master Mix (New England BioLabs) on a thermocycler with the following program ...
-
bioRxiv - Immunology 2021Quote: ... Reverse transcription reactions were performed with 6 μl of purified RNA and random primers using the NEB ProtoScript II First Strand cDNA Synthesis Kit (NEB, E6560S), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... 510 ng (6 µl at 85 ng/µl) of DNA was digested using endonucleases EcoRI and MseI (New England BioLabs, Inc.) after which barcoded (EcoRI cut site ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were made with 6 ng of CUT&RUN DNA fragments using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645S). The manufacturer’s protocol was adjusted to account for shorter DNA fragments as described previously 45.
-
bioRxiv - Genomics 2023Quote: The purified cDNA was PCR amplified for 6 cycles to generate dsDNA with NEBNext Ultra II Q5 High-Fidelity 2X Master Mix (NEB, M0544) and 0.5 uM PCR primers with unique dual index using the following PCR cycles:
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were made with 6 ng of CUT&RUN DNA fragments using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645S). The manufacturer’s protocol was adjusted to account for shorter DNA fragments as described previously (33) ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNA barcodes were amplified by PCR using the gDNA from at least 6 mio cells as template and Phusion (NEB M0530) as polymerase ...
-
bioRxiv - Genomics 2022Quote: ... a donor template with the EGFP-stop-codon cassette including a 6 times glycine-alanine spacer sequence was cloned in between the two homology arms by using MluI (NEB: R0198S) and BglII (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was collected from parental iOvCa147 cells and DYRK1A-/-cells from 24-hour adherent or 6-hour spheroid conditions using the Monarch Total RNA Miniprep Kit (NEB #T2010S) as described above ...
-
High-resolution profiling reveals coupled transcriptional and translational regulation of transgenesbioRxiv - Synthetic Biology 2024Quote: ... cDNA was synthesized from 6 µL of eluted RNA using the ProtoScript First Strand cDNA Synthesis Kit (New England Biolabs, E6300) with oligo-dT primers ...
-
bioRxiv - Plant Biology 2024Quote: ... Site-directed mutagenesis was performed to generate the AeCRKG359E (inactive kinase mutation) and AeRLCK2G110E (rlck2-6 mutant allele mutation) variants using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs). The primers used were AeCRKkin_Mut_G359E_F and AeCRKkin_Mut_G359E_R and the AeRLCK2mutL42F and AeRLCKmutL42R ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 – 30 µL of cDNA was amplified by 6 to 12 PCR cycles using Illumina indexing primers and Q5 polymerase (New England Biolabs, M0491). For a typical miRXplore miRNA library from 500 ng input ...
-
bioRxiv - Biophysics 2024Quote: The 2N4R isoform of 6×His-tagged human tau protein was cloned into the pRK172 vector and expressed in LEMO21 cells (NEB #C2528J). Cells were cultured in TB media at 37 °C until the OD600 reached 0.6 ...
-
bioRxiv - Genetics 2024Quote: ... genomic DNA was extracted from approximately 6 million COLO320-DM cells using the Monarch HMW DNA Extraction Kit for Tissue (NEB #T3060L) following the Oxford Nanopore Ultra-Long DNA Sequencing Kit V14 protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Whole-genome data for these latter strains was obtained by extracting genomic DNA from 6 pooled adult aphids using a Monarch® Genomic DNA Purification Kit (New England BioLabs), one pool per strain ...
-
bioRxiv - Developmental Biology 2024Quote: Cells at passage 35-60 were harvested as a single cell suspension using TrypLE Express and 800K cells were nucleofected in 100 μl final volume containing either 2 μg of the Cas9 nickase expression vector 47 with 1 μg of each of the two sgRNAs and 10 μg of the targeting vector (for the INS eGFP allele) or 6 μl Cas9-NLS protein (120 pmol, NEB, M0646M) with 2 μg of each of the sgRNAs (Table S2 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 µl were used for amplification with Taq 2X Master Mix (New England Biolabs, Ipswitch, USA) using a 20-cycles PCR protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Developmental Biology 2020Quote: ... Approximately 1kb 5’ and 3’ Homology arms were assembled using HiFi DNA Assembly (New England Biolabs) upstream and downstream of this cassette with the following primers (5’-3’):
-
bioRxiv - Physiology 2021Quote: ... RNA 3’ end dephosphorylation reaction consisted of T4 PNK (20 U/10 μL sample, NEB M0201S), SuperaseIn in 1X T4 PNK buffer without ATP for 60 min at 37 °C ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA from A549 cells (3 µg in 30 µl) was treated with RppH (NEB M0356) at 30 °C for 1 hr and purified by spin column ...
-
bioRxiv - Genomics 2020Quote: ... Fragmented RNAs were then dephosphorylated at their 3’ end using PNK (New England Biolabs, Cat: M0201) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Biochemistry 2021Quote: ... Table 3) region of clpP1 was amplified by PCR (GC buffer, Phusion polymerase, New England Biolabs) using isolated L ...
-
bioRxiv - Biochemistry 2020Quote: ... Desalted peptides were dissolved at a concentration of 3 µg/µL in 1x CutSmart buffer (NEB, 50 mM potassium acetate ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Biophysics 2021Quote: Purified plasmids were digested at the 3’ end of the insert sequence with EcoRI-HF (NEB) to linearize the template with a 5’ overhang for in vitro transcription ...
-
bioRxiv - Genomics 2022Quote: ... 3 ug of input DNA was dephosphorylated with Quick CIP (New England Biolabs, cat no M0508). Following enzyme inactivation with alkaline phosphatase ...
-
bioRxiv - Bioengineering 2022Quote: ... NU-1707L) was added to the probes’ 3’ ends with Terminal Transferase (New England Biolabs, M0315L), which adds a single azido-dATP molecule ...
-
bioRxiv - Developmental Biology 2022Quote: ... Ribosome footprints were generated by incubating the lysate with 3 U/µg of micrococcal nuclease (NEB) for 40 min at 25° C ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Developmental Biology 2020Quote: ... The bcd-3’UTR was PCR amplified using Q5 high-fidelity polymerase (New England Biolabs, M0491S) from genomic DNA using the primers 5’-GAGTCATCA-TCATCAGTTTCGTCAAAAGTAACCTGGATGAGAGGCGTGTTAGAG-3’ and 5’-CTGGGTCG-GCGCGCCCACCCTTGTCTAGGTAGTTAGTCACAATTTACCCGAGTAGAGTAG-3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... rinsed with PBS and incubated in PBS containing 3% molecular biology grade BSA (New England Biolabs) and 0.05% Tween-20 for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... Then the piggy-bac vector pPBhCMV1-miR(BsgI)-pA-3 was digested with BsgI (#R05559S, NEB) and the digested vector excised from a DNA agarose gel and the DNA purified ...