Labshake search
Citations for New England Biolabs :
1151 - 1200 of 2342 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... RNA 5’ adaptor was ligated using T4 RNA Ligase 1 - high concentration (NEB) and 10 mM ATP ...
-
bioRxiv - Microbiology 2021Quote: ... 5’UTR was obtained using the Template Switching RT Enzyme Mix (NEB #M0466) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: 5’ linker ligation (1x PNK buffer, 40 u T4 RNA ligase I (NEB), 80 u RNaseOUT ...
-
bioRxiv - Genomics 2021Quote: ... In step 5 extra free oligo was removed by Thermolabile Exonuclease I (NEB). After adding 50 ng of carrier DNA (poly (A) ...
-
bioRxiv - Plant Biology 2023Quote: ... for 5 h in 4ml volume using 100U of T4 DNA ligase (NEB). After reverse crosslinking and Proteinase K treatment (Invitrogen) ...
-
bioRxiv - Plant Biology 2023Quote: ... treated with 5 µg/mL Proteinase K (New England Biolabs Inc., MA, US) for 5 mins ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reaction was set up using ARCA (NEB, S1411L or Trilink, N-7003-5) and N1-Methylpseudouridine-5’-Triphosphate (Trilink ...
-
bioRxiv - Genomics 2023Quote: ... and A-tailed with Klenow Fragment (3’-to-5’ exo-, New Englands Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.5 mM CaCl2) combined with DNase I (10 U = 5 μl; NEB, M0303L) at 37°C for 40 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ end phosphorylation (1x PNK buffer, 20 U T4 PNK (NEB, Cat# M0201L), 80 U RNaseOUT ...
-
bioRxiv - Microbiology 2022Quote: ... Isolated DNA (5 μg) was digested overnight with PstI-HF (New England Biolabs) and resolved on a 0.7% 1x TBE agarose gel stained with SYBR Safe (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µl of Luna® Universal qPCR Master Mix (Biolabs, Ipswich, MA, USA) and 2 μl from 1:20 diluted cDNA template.
-
bioRxiv - Genomics 2024Quote: ... 5 μM each) from IDT were annealed in 1x New England Biolabs (NEB) buffer 2 (20 μl in total) ...
-
bioRxiv - Neuroscience 2024Quote: ... the construct was diluted 1:5 with empty pUC19 vector (New England Biolabs) and then transfected with 7.5 µL of TransIT-293 and 2.5 µg of DNA ...
-
bioRxiv - Biophysics 2023Quote: ... DNA was purified using Monarch PCR & DNA Cleanup Kit (5 μg) (NEB, T1030S) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Eluted cDNA was amplified 5-cycles (NEBNext Ultra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Genomics 2023Quote: ... and 5 μL of 300,000 U/mL MNase (New England Biolabs, CAT #M0247S). Efforts were made to avoid freeze-thaw cycles of the MNase enzyme ...
-
bioRxiv - Genetics 2024Quote: ... 50 μl of MNAse digestion buffer (5 gelUnits/μl Micrococcal Nuclease (NEB M0247S), 2X Micrococcal Nuclease buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was phosphorylated at the 5’ end by T4 polynucleotide kinase (NEB) and ligated to the 5’ adapter (Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ ends were hydroxy-repaired by adding T4 polynucleotide kinase reaction mix (NEB) which was incubated for 45 minutes at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Eluted cDNA was amplified 5-cycles (NEBNext Ultra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Microbiology 2022Quote: ... the RNA 5′ ends were phosphorylated with T4 polynucleotide kinase (New England Biolabs). Adapters were ligated to the 5′ and 3′ ends of the RNA and first-strand cDNA synthesis was performed using M-MLV reverse transcriptase ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 µL reaction volume contained 2.5 µL Luna® Universal qPCR mastermix (NEB). RT-qPCR analyses were performed using the Real-time PCR Roche Lightcycler 480 and the expression of PP2AA3 (At1G13320 ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM DTT) or 5 units of RNASEH1 enzyme (M0297, New England Biolabs) for 30 mins at 37 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Trypsin digestion was stopped by adding 5% BSA (ref. B9000S, New England Biolabs) and the cell suspension was passed through a 40 µm Flowmi cell strainer (ref ...
-
bioRxiv - Cell Biology 2023Quote: ... EcoRI and XbaI 5’ overhangs were filled in with dGTP (New England Biolabs), dCTP (New England Biolabs) ...
-
bioRxiv - Systems Biology 2023Quote: ... and 72°C for 5 min) (Phusion High-Fidelity DNA Polymerase, NEB, M0530S) using the P7 and a T7-fused P5 primer (5′ TAA TAC GAC TCA CTA TAG GGA ATG ATA CGG CGA CCA CCG A 3′ ...
-
bioRxiv - Biochemistry 2024Quote: ... and then ligated to cDNA using Thermostable 5’ App DNA/RNA Ligase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 mM BME) onto a 10 ml amylose column (New England Biolabs). The amylose column was washed with lysis buffer ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM MgCl2 and 2 U of recombinant Escherichia coli RNase HI (NEB) were added ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were purified using Monarch PCR & DNA Cleanup Kit (5 μg; NEB) and checked on 1% agarose gel and approximately 600 ng of each PCR product was used as template for in vitro dsRNA synthesis according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... DNA fragments were mixed with Hydrophilic Streptavidin Magnetic Beads (5 µl) (NEB #S1421S) and binding buffer (500 µl ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was degraded with 5 units of each RNase H (BioLabs cat #M029L) and RNase A/T1 (Thermo Scientific cat #EN0551) ...
-
bioRxiv - Biophysics 2024Quote: ... PM187B20 was 5’ end labelled using 1 μL T4 polynucleotide Kinase (NEB, M0201S), 1 μL γ 32P ATP (Perkin Elmer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 and 5 minutes by the addition of 0.8 units Proteinase K (NEB). Fragments were resolved on 1% agarose gel and band intensities were quantified on Image Lab (BioRad).
-
bioRxiv - Genomics 2024Quote: ... 5 units of PolyA polymerase (E. coli or yeast as appropriate) (NEB#M0276S). The reaction was incubated at 37°C for either 7 or 30 minutes and stopped by purification with a MEGAclear column (Termofisher AM1908 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Eluted cDNA was amplified 5-cycles (NEBNext Ultra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Bioengineering 2024Quote: ... phosphorylated at the 5’ ends with T4 polynucleotide kinase (New England Biolabs M0201), annealed to generate a double-stranded insert ...
-
bioRxiv - Cancer Biology 2024Quote: ... Eluted cDNA was amplified 5-cycles (NEBNext Ultra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Bioengineering 2024Quote: ... Tagmentation reactions were halted using 5 µL of a 50% proteinase K (NEB) solution (mixed with H2O ...
-
bioRxiv - Bioengineering 2024Quote: ... Tagmentation reactions were halted using 5 µL of a 50% proteinase K (NEB) solution (mixed with H2O ...
-
bioRxiv - Cancer Biology 2024Quote: ... The initial 5 cycles of PCR were performed using Q5 polymerase (NEB M0491), 200uM dNTPs (Invitrogen 10297-018 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.5 μl Klenow fragment (3′ to 5′ exo-, Cat. #M0212L; New England Biolabs) and 0.5 μl T4 Polynucleotide Kinase (Cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction was initiated by diluting the LbCas12a complexes to a final concentration of 37 nM LbCas12a : 37 nM sgRNA in a solution containing 1X NEBuffer 2.1 (NEB) and 1 µM custom ssDNA reporter substrates in a 40 μL reaction volume ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and resuspended in 50 µL of 1 mg/mL RNAse A solution (New England Biolabs, Ipswich, Massachusetts, United States) and statically incubated at 37 °C for 3 h ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were then resupended in 100 µL Ligase Solution (50mM HEPES pH 7.5, 10 mM MgCl2, 1mM rATP (New England Biolabs), 9.5 nM Connector oligomer (TTTCACGACACGACACGATTTAGGTC ...
-
bioRxiv - Molecular Biology 2020Quote: ... the cells were washed in 800 µL of 1.2X CutSmart solution (from 10X CutSmart stock (NEB, #B7204S, Ispwich, MA)) and pelleted at 900 g for 2 min ...
-
bioRxiv - Genetics 2022Quote: ... Eggs were then injected under air-dry conditions with a solution containing 300ng/μl of recombinant Cas9 Nuclease (NEB) and 100ng/ul each of four sgRNAs targeting the first exon of the Oatp74D gene (S2 Table) ...
-
bioRxiv - Genomics 2022Quote: ... Next, 500 nL of MspJI digestion mix (1x NEBuffer 4, 8x enzyme activator solution, 0.1 U MspJI (NEB, R0661L)) was added to each well and the plates were incubated at 37°C for 4.5 hours ...
-
bioRxiv - Genomics 2020Quote: ... Transformation efficiencies of all strains were monitored and normalised using a stock solution of pLITMUS28 (New England Biolabs, USA). In addition ...