Labshake search
Citations for New England Biolabs :
1101 - 1150 of 2342 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Nuclei were subjected to a methylation labeling reaction using a solution of 1x M.CviPI Reaction Buffer (NEB), 300 mM sucrose ...
-
bioRxiv - Microbiology 2020Quote: ... Stock solutions of SNAP-Cell® TMR-Star or SNAP-Cell® 647-SiR (New England Biolabs) in DMSO were diluted to 4 μM in complete medium ...
-
bioRxiv - Genetics 2020Quote: ... 10 mL of a 10% BSA solution was incubated with 2.5 μL of Proteinase K (NEB P8107S) for 30 minutes at room temperature (∼22°C) ...
-
bioRxiv - Biochemistry 2023Quote: ... 50 ul of aqueous solution were recovered and treated with 0.3 U of calf intestinal phosphatase (NEB) for 1 h at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... beads were washed twice with coIP-solution and finally dissolved in RNA protection buffer (New England Biolabs).
-
bioRxiv - Cancer Biology 2023Quote: ... and the samples were incubated overnight at 47℃ in clearing solution comprised of Protease K (NEB, P8107S) and Clearing Premix (Vizgen ...
-
bioRxiv - Biochemistry 2023Quote: ... The resulting solution was cooled down to 42°C before adding 2 U of β-agarase (NEB), gently mixing the solution by end-over-tube inversion ...
-
bioRxiv - Biophysics 2024Quote: ... solutions containing polySH3 and cleaved MBP- and His6-tags were passed over Amylose resin (New England Biolabs) to remove excess MBP ...
-
bioRxiv - Neuroscience 2024Quote: ... the samples were cleared overnight at 37°C with a Clearing Solution containing Proteinase K (NEB P8107S) and Clearing Premix (Vizgen 20300003) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Tissue samples were stored in DNA/RNA stabilizer solution at -80°C (New England Biolabs, Frankfurt, Germany) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ triphosphates on the synthesis products were converted into 5’ monophosphates: samples were treated with recombinant shrimp alkaline phosphatase (NEB) (10 µl reaction in 1× NEB buffer 2.1, 37°C 30 min, 65°C 5 min), these reactions were made up to 15 µl including 0.5 µl 10× NEB 2.1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... their nuclei were isolated via centrifugation then resuspended in a 0.5 ml solution comprising 1.2 × restriction enzyme NEBuffer™ r3.1 (NEB) containing 0.3% SDS ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were deglycosylated with PNGase F by adding 5μl of a solution consisting of 18μL of Glycobuffer 2 (10x) and 27μL of PNGaseF (NEB, P0708S). Endoproteinase Lys-C (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... The cleaved 6xHis-MBP tag was removed by incubating the solution with Ni-NTA magnetic beads (NEB; S1423) for 1 hour at 4 °C ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... The wash solution was then replaced with 1× T4 polymerase buffer containing 30 U T4 DNA polymerase (NEB) and incubated at 12 °C for 30 min ...
-
bioRxiv - Biochemistry 2022Quote: ... the supernatant solution was incubated for at least 2□h with amylose-affinity chromatography resin (New England Biolabs), whilst gently shaking at 4□°C ...
-
bioRxiv - Microbiology 2024Quote: ... Amplifications were carried out in 20 μl reaction solutions containing 1X Luna® Universal qPCR Master Mix (NEB), 20 ng cDNA and 0.25 μM each gene-specific primer ...
-
bioRxiv - Cell Biology 2024Quote: ... in a reaction solution containing 50 mM sodium phosphate (pH 7.5) and 1% NP-40 (B2704S, NE BioLabs) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: A reaction solution of 100 µL containing 0.32 units/µL Bst DNA polymerase large fragment (New England Biolabs), 0.5 µM forward primer ...
-
bioRxiv - Cell Biology 2020Quote: 5′ end phosphorylation and radiolabeling (1x PNK buffer, 40 U T4 PNK (NEB), 40 μCi 32P-γATP ...
-
bioRxiv - Cell Biology 2020Quote: 5′ linker ligation (1x PNK buffer, 40 U T4 RNA ligase I (NEB), 80 U RNasIN ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 μg of nucleic acid was digested with 5 μL RNase H (NEB) at 37°C for 16 hours and 10 μg was mock digested without RNase H ...
-
bioRxiv - Molecular Biology 2021Quote: ... which was treated with 5 units of T7 endonuclease 1 (New England Biolabs) for 20 min at 37 °C and analyzed by 2% agarose gel electrophoresis ...
-
bioRxiv - Molecular Biology 2020Quote: ... except that 5 uL of Phusion Hot Start Flex 2X Master Mix (NEB) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... Eluted cDNA was amplified 5-cycles (NEBNext Ultra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Molecular Biology 2021Quote: The 5’ RACE PCR product was digested using BamHI (New England Biolabs R0136) and EcoRV (New England Biolabs R3195 ...
-
bioRxiv - Genetics 2020Quote: ... 3 µl of dNTPs (2.5 mM each) and 5 U Klenow exo- (NEB) and incubating for 1 h at 30°C ...
-
bioRxiv - Biochemistry 2021Quote: 100 μl extension reactions were performed with Klenow Fragment (3’→5’ exo-) (NEB) (Figures 2B ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5 μg were digested overnight at 37°C with FspEI (NEB, R0662S), which recognizes CMC sites and creates a double-stranded DNA break on the 3’ side of the modified cytosine at N12/N16 ...
-
bioRxiv - Genomics 2021Quote: ... 5’-ENGRAM 2.0 recorder was digested with Xbal and Ncol (NEB, CutSmart buffer) at 37°C for 1h and purified ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL of linker ligation mixture was added (38% PEG-8000, 1x NEB T4 ligase buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenylation of R1R was done using 5’ DNA Adenylation kit (New England Biolabs) according to manufacturer’s instructions and cleaned with Oligo Clean & Concentrator (Zymo Research ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAs were 5′-labeled with 32P-γ-ATP using T4 polynucleotide kinase (NEB) and purified on P-30 spin columns (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... RNA was phosphorylated on the 5’ end using T4 polynucleotide kinase (NEB, M0201L) then ligated onto a 5’ adapter ...
-
bioRxiv - Genomics 2022Quote: ... then perform A-tailing with Klenow Fragment (3’-> 5’ exo-) (NEB, Cat. M0212S) provided with dATP ...
-
bioRxiv - Microbiology 2022Quote: ... golden-gate compatible template was created by 5’-phosphorylating with T4 PNK (NEB) and annealing of oligonucleotides ...
-
bioRxiv - Bioengineering 2022Quote: Escherichia coli (E. coli) strain NEB 5-α (New England Biolabs, Hertfordshire, UK) was used for generation of genetic constructs ...
-
bioRxiv - Bioengineering 2022Quote: ... the 5’ ends were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs, M0201L). Each gene-specific pool of 51mer oligonucleotides was mixed with a 20mer ligation adapter (ACAGTCACTTCAACACTCAG ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (1:10, #P0756S, New England Biolabs). The reaction was incubated in a thermocycler for 37 °C for 30 min ...
-
bioRxiv - Biochemistry 2022Quote: DNA or RNA was labeled at 5′-termini with T4-Polynucleotide kinase (NEB) using ψ-P32-ATP as indicated in Figure 2 ...
-
bioRxiv - Genomics 2020Quote: ... 8 μL of 5 M NaCL and 1 μL of RNase A (NEB) were added to every 200 μL of eluate and to the WCE samples (diluted to 200 μL with Elution buffer) ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction mixture was then incubated with 5 units of Antarctic Phosphatase (NEB) for 1 h at 22 °C to hydrolyze unreacted GTP ...
-
bioRxiv - Microbiology 2021Quote: ... Bound RNA was degraded with 5 units of RNase H (New England Biolabs) and the cDNA purified by ethanol precipitation overnight at −20 °C (3x volumes of ethanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ phosphorylation and 3’ dephosphorylation were performed with T4 PNK (NEB, Cat: M0201S) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µl Reverse External Primer (10 µM) and Nuclease-free water (NEB,USA) up to 100 µl were mixed on ice ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and A-tailed using Klenow 3’-5’exo-enzyme (NEB, Cat. No. M0212). Illumina sequencing library adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μM of SNAP-surface549 or SNAP-surface649 (New England Biolabs; Ipswich, MA) was incubated with the beads rotating overnight at 4°C ...
-
bioRxiv - Genetics 2020Quote: ... and purified with Monarch PCR & DNA Cleanup Kit (5 μg) (NEB, Ipswich, USA), checked on an 1 % (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.15mM of 7-deaza-dGTP (7-deaza-2′-deoxyguanosine 5′-triphosphate, NEB).
-
bioRxiv - Genomics 2020Quote: ... the genome was digested by 5 μl enzyme HaeIII (10 U/μl, NEB) with 81.5 μl H2O ...