Labshake search
Citations for New England Biolabs :
1151 - 1200 of 4748 citations for 8 BROMO 2 3 4 5 TETRAHYDRO 1H PYRIDO 4 3 B INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Homology arms and exon 3 of the murine Akr1b3 locus were amplified with Q5 polymerase (New England Biolabs) using genomic DNA from mouse R1 ES cells (23) ...
-
bioRxiv - Systems Biology 2021Quote: ... Adaptors for Illumina sequencing were added via PCR amplification using Nspacer_barseq_pHIMAR (Wetmore et al., 2015) and NEBNext Index 3 Primer for Illumina (New England Biolabs). Cycle conditions were 30 seconds 98°C followed by 4 cycles (15 seconds 98°C ...
-
bioRxiv - Genomics 2020Quote: ... The sample was then combined with 3’ RNA Ligase Master Mix (8μL 50% PEG 8000, 2μL 10x T4 RNA Ligase Buffer (B0216L, NEB), 1.5μL nuclease free water ...
-
bioRxiv - Neuroscience 2021Quote: ... Phosphatase treated samples were enzymatically treated for 3 n at 37°C shaking (1.25 μl 10 μM MnCl2, 1.25 μl 20X NEB buffer ...
-
bioRxiv - Genomics 2021Quote: ... Resulting supercoiled plasmid is linearized at the 3’ end of the PolyA tail using BamHI-HF (NEB R3136S), and checked for reaction completion by running on agarose gel ...
-
bioRxiv - Genetics 2020Quote: ... the mutant Tile 3 was subcloned into the full length AttB-KCNH2-HA:IRES:mCherry by restriction digest with BglII and NdeI (NEB) and ligation with T4 ligase (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: Ligation workups from the previous step were supplemented with 3 μL of 6X purple gel loading dye (NEB), heat denatured at 85 °C for 1 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the previously constructed genome-integrating vector pCS75 (25) (Supplementary Table 3) was cleaved with PmeI and EagI (NEB), the resulting fragments were separated on a 0.8% agarose gel ...
-
bioRxiv - Genomics 2023Quote: ... nick ligation was then performed in a 30 µL reaction with 3 µL of 10x rCutSmart Buffer (NEB), 1.56 µL of 500 µM β-Nicotinamide adenine dinucleotide (NAD+ ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 3’ A-addition and adapter ligation using a custom reagent formulation (New England BioLabs, E6000B-10). Libraries were pooled in equal molar amounts and were sequenced using an Illumina HiSeqX platform (Ilumina ...
-
bioRxiv - Molecular Biology 2023Quote: CDKN1A intron 1 APA 3’ splice site was deleted using Q5 Site-Directed Mutagenesis Kit (New England Biolabs) as per the manufacturer’s instructions using forward primer (5’-TCCCCACCCCAAAATGACGCGCAGCC-3’ ...
-
bioRxiv - Developmental Biology 2023Quote: ... At least 3 sgRNAs per gene were cloned using ssDNAs oligoes (IDT) and NEBuilder HiFi DNA Assembly (NEB) into modified backbone ...
-
bioRxiv - Microbiology 2023Quote: ... The 3′ ends of purified RNA were dephosphorylated with the addition of T4 PNK enzyme (New England Biolabs) and 10 mM ATP was added to phosphorylate the 5’ ends of the RPF (ribosome protected fragments) ...
-
bioRxiv - Microbiology 2023Quote: Purified vigR 3’ UTR amplified from JKD6008 was in vitro transcribed (IVT) using HiScribe T7 RNA polymerase (NEB). RNA products were DNase I treated (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ligation of the RNA 3’ Adapter (RA3) was achieved by using T4 RNA Ligase 1 (NEB, Ipswich, MA) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The ligations were transformed into high efficiency (1-3 × 109 CFU/μg pUC19 DNA) competent cells (NEB C3040). The transformations were serially diluted and plated on LB with ampicillin (100 μg/ml) ...
-
bioRxiv - Genomics 2023Quote: ... CBS 112042+ and CBS 124.78+ were sequenced on R9.4.1 flowcells using the LSK108 kit with 3 μg DNA as input for the end prep reaction (NEB ULTRA-II EP ...
-
bioRxiv - Microbiology 2024Quote: ... 1.25 µL native ligation barcode (ONT SQK-NBD114-96) and 3 µL Blunt/TA Ligase Master Mix (NEB). The reaction was mixed by pipetting ...
-
bioRxiv - Cell Biology 2023Quote: Ifnb1 mRNA 3’ UTR (NM_002176.4) was synthesized using the HiScribe T7 High Yield RNA synthesis kit (NEB, E2040S) through in vitro transcription ...
-
bioRxiv - Genomics 2024Quote: ... 3.) Library preparation was performed using the NEBNext Ultra II library preparation kit for Illumina (New England Biolabs) and 4. ...
-
bioRxiv - Microbiology 2019Quote: ... 7.5 μL solution B (NEB #E6800), 2 μL E ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 µl was used for BglII digestion (NEB, 2 hours at 37°C) and the products were loaded on a 2% agarose gel to confirm the pAS insertion ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.15mM of 7-deaza-dGTP (7-deaza-2′-deoxyguanosine 5′-triphosphate, NEB).
-
bioRxiv - Microbiology 2019Quote: ... and 4 μL was ligated at 16°C overnight with the T4 DNA ligase (NEB M0202S). After transformation into chemically-competent Top10 E ...
-
bioRxiv - Biophysics 2021Quote: ... Primers were designed for the replacement of each of the 4 loops using Q5 polymerase (NEB) PCR reaction and a KLD enzyme mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... after ligation overnight at 4°C with the T4 DNA ligase (New England Biolabs, Evry, France).The sequences of the cloned fragments in the resulting plasmids pYES2::MlpCSP1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mM DTT) supplemented with 200 μM cold SAM (S- adenosyl methionine) (NEB; for immunoblotting) or 1 µCi 3H-labelled SAM (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... Donor 4) were combined in a single ligation reaction using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions and incubated overnight at 16°C ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were collected and incubated with 4 μM SNAP-Cell TMR-Star (New England Biolabs S9105) or SNAP-SiR647 (New England Biolabs S9102 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the extension enzyme was replaced with 4 units of Bst 2.0 Warmstart DNA Polymerase (NEB, Cat.No.M0538). Correspondingly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse transcription was initiated by adding 4 μl of 5X ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Biochemistry 2019Quote: ... 4°C) and the supernatant was added to 24 mL of amylose resin (NEB, Ipswich MA) pre-equilibrated with buffer C and nutated for 2 hr at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... After overnight incubation at 4°C in PBS-Perm with rabbit anti-GFP (1:1000, Biolabs) and mouse anti-MAP2 (1:2000 ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 pmol of double-stranded DNA was labeled with 1 unit of Klenow fragment polymerase (NEB) and 8 pmol Cy5-dCTP (Cytiva ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 5 min and then samples were incubated with ligation buffer (8 μl of 5x ligation stock (New England Biolabs, USA), 1 μl ligase and 31 μl of ultrapure water on each coverslip ...
-
bioRxiv - Developmental Biology 2023Quote: ... Eluted fragments were amplified by PCR with an appropriate number of PCR-cycles (5-8) using Custom NExtera PCR primers50 and the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S). Amplified DNA was purified using Qiagen MinElute Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... The end-repaired DNA was ligated with 5 μl Adapter Mix (ONT, SQK-LSK110) using 8 μl NEBNext Quick T4 DNA ligase (NEB, E6056) at 21°C for up to 1h ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was buffer exchanged into enterokinase cleavage buffer (20 mM Tris pH 8, 50 mM NaCl, 2 mM CaCl2) and cleaved using bovine enterokinase (EK, NEB) at 16U/mg protein for 4 hrs ...
-
bioRxiv - Molecular Biology 2021Quote: ... after incubating the samples with 2 μl of RNase A (Thermo) at 37 °C for 2h and then with 8 μl of proteinase K (NEB) at 55 °C for 4h ...
-
bioRxiv - Immunology 2022Quote: ... 2018” tagmentation mix were either sorted into plates containing RCB buffer for condition “hiSDSprotK-TWEEN” (2 x RCB: 100 mM Tris-HCl pH 8, 100 mM NaCl, 40 µg/mL Proteinase K (NEB), 0.4 % SDS (Sigma ...
-
bioRxiv - Genomics 2021Quote: ... The PCR mix (8 µl H2O, 2 µl primer mix P5Solexa/P3Solexa, 10 µM each, 20 µl Phusion HF Mix [New England Biolabs]) was added to 10 µl cDNA ...