Labshake search
Citations for New England Biolabs :
1401 - 1450 of 4748 citations for 8 BROMO 2 3 4 5 TETRAHYDRO 1H PYRIDO 4 3 B INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: Each 900 ng of high molecular weight NA12878 DNA was preprocessed by first blocking at the 3’ ends with Klenow (exo-) (NEB) in the presence of 10 µM dideoxynucleotides and 1X NEBuffer 3.1 for 30m at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... The backbones for the Gibson reaction for GRB2-SH3 and PSD95-PDZ3 library assembly (aPCA plasmids) were first linearized using primers listed in Extended Data Table 3 and next treated with Dpn1 (NEB) restriction enzyme to remove the circular plasmid template ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was diluted 1:10 and 3 µl of diluted cDNA was used as input for qPCR using Luna by NEB master mix for a 20 µL total reaction ...
-
bioRxiv - Molecular Biology 2024Quote: ... IP samples underwent on-bead ligation of barcoded RNA adapters (/5phos/rArGrArUrCrGrGrArArGrArGrCrGrUrCrGrUrG/3SpC3/) to the 3’ end using T4 RNA ligase (New England Biolabs). Following elution ...
-
bioRxiv - Neuroscience 2024Quote: Adult worms from INF418 (nonEx106[myo-2p::GCaMP8f::unc-54 3’UTR]) and INF96 (syIs391[myo-2p::NLS::GAL4SK::VP64::unc-54 3’UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] ...
-
bioRxiv - Molecular Biology 2024Quote: The golden gate assembly reaction was assembled in a PCR tube by mixing 100 ng of the vector with a 3 fold molar excess of the purified PCR product (calculated using the NEB bio calculator ...
-
bioRxiv - Bioengineering 2024Quote: ... Illumina adapters were ligated on at the 3′ end of the complementary strand using 1× TA Ligase Master Mix (NEB). All products were indexed and sequenced on an Illumina MiSeq instrument ...
-
bioRxiv - Plant Biology 2023Quote: ... without its Stop codon and with a Gly-Gly-Ser-Gly-linker at the 3’-end was first amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the primers GGB_OEP7_F – AACAGGTCTCAAACAATGGGAAAAACTTCGGGAGC and GGC_OEP7_GGSG_R – AACAGGTCTCTAGCCTCCAGATCCTCCCAAACCCTCTTTGGATGTGG ...
-
bioRxiv - Cancer Biology 2024Quote: ... and two BsmBI Type IIS restriction enzyme sites was cloned into the 3’ end of the bovine U6 promoter using Gibson Assembly (NEBuilder HiFi, NEB) (see Supplementary Figure 1a) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-ACG CGT ACT AGT CGA TCG CTT GTA CAG CTC GTC CAT G-3’ (reverse primer) and using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Barcode cassette was amplified from genomic DNA with primers P5.seq-B-GLI.v1 and P7.seq-B-GLI.v1 using OneTaq® DNA Polymerase (NEB, cat ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were split into two separate reaction tubes containing 8 μL of PCR product + 1 μL 10X NEB® Buffer #2 (New England Biolabs®). These were incubated in a thermocycler with an initial denaturation of 95 °C for 5 minutes ...
-
bioRxiv - Bioengineering 2019Quote: ... 5 μL of 10 × GlycoBuffer 2 (supplied by NEB, 500 mM Sodium Phosphate, pH 7.5), and 1 μL of PNGase ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Phusion High Fidelity 2× Master mix (New England Biolabs, Beverly MA, USA) and 2 μL of 10 μM standard Illumina P1 and P2 primers ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was removed by adding 2 μL DNaseI and 5 μL 10x DNase buffer (NEB) to the purified RNA and incubated at 37C for 30 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... overnight at 4°C followed by Alexa Fluor 488 goat anti-rabbit secondary antibody (New England Biolabs, UK) for 1h ...
-
bioRxiv - Molecular Biology 2019Quote: ... centrifuged 10min at 4000g and incubated with oligo(dT)25 beads 30min at 4°C (New England Biolabs). Remaining steps for polyA RNA isolation were performed as described [18] ...
-
bioRxiv - Genomics 2020Quote: ... CpG dinucleotides were methylated by incubating 1µg of DNA with S-Adenosyl methionine (SAM) (32µM) with CpG Methyltransferase (M.SssI) (4-25 units) (New England BioLabs) at 37°C for 1h before heating to 65°C for 20mins.
-
bioRxiv - Genomics 2020Quote: ... by incubating 1µg of DNA with S-Adenosyl methionine (SAM) (32µM) with CpG Methyltransferase (M.SssI) (4-25 units) (New England BioLabs) at 37°C for 1h before heating to 65°C for 20mins.
-
bioRxiv - Cell Biology 2020Quote: ... The extract was incubated for 1 h at 4 °C with amylose resin (New England Biolabs, Ipswich, MA), loaded onto a column ...
-
bioRxiv - Systems Biology 2020Quote: Single hematopoietic stem and progenitor cells were index-sorted into 384 well plates containing 0.5 µl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB), spun down and frozen at −80°C ...
-
bioRxiv - Systems Biology 2021Quote: ... Then a plasmid library was assembled using 4 independent reactions of NEBuilder HiFi DNA Assembly (New England Biolabs) to avoid biases in assembly that might affect the library’s distribution ...
-
bioRxiv - Biochemistry 2022Quote: ... The unbound fraction was then incubated for 1 hour at 4 °C with lambda phosphatase (New England Biolabs), calf intestinal phosphatase (New England Biolabs) ...
-
bioRxiv - Cell Biology 2022Quote: ... pEXKm5 was digested with HindIII and the 4 fragments were assembled via Gibson cloning (New England Biolabs, E2611S).
-
bioRxiv - Microbiology 2022Quote: ... DNA was synthesized from extracted RNA using 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was synthesized from extracted RNA using 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Neuroscience 2021Quote: ... nuclei were resuspended in 200uL digestion buffer with 4 uL protease (an equal volume of protease K (NEB) was substituted if the manufacturer-provided protease was exhausted ...
-
bioRxiv - Genomics 2019Quote: ... (iii) Polymerase for Ad2 amplification: Libraries #1 and #4 were amplified using Q5 high-fidelity DNA polymerase (NEB). Library #2 was amplified using Pfu Turbo Cx ...
-
bioRxiv - Molecular Biology 2020Quote: ... the single cell tagmentation product was mixed well with 4 units of Bst 3.0 DNA Polymerase (NEB, Cat.No.M0374) and indexed common primers (Vazyme ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 million permeabilized cells (without any antibodies bound) were incubated with 4 units of Dam enzyme (NEB, M0222L) during the activation step ...
-
bioRxiv - Genomics 2021Quote: ... We then performed a kinase treatment adding 4 μl of T4 Polynucleotide Kinase (PNK, New England BioLabs Inc.), 5 μl of 10X PNK buffer ...
-
bioRxiv - Plant Biology 2019Quote: ... Purified DNA fragments were ligated overnight at 4°C with T4 DNA ligase (New England Biolabs, Ipswich MA) per manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and 4 µl of hot PNK mix (0.2 µl PNK [New England Biolabs] ...
-
bioRxiv - Synthetic Biology 2021Quote: ... annealed by temperature decrease from 95 °C to 4 °C and phosphorylated using T4 Polynucleotide Kinase (NEB, M0201) according to manufactures’ protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 12 h at 4 °C with 10 μg of Factor Xa protease (New England Biolabs, Hitchin, UK) per 1 g of mitochondria ...
-
bioRxiv - Biochemistry 2021Quote: ... The resulting Gβ1γ2 was then incubated for 1 hour at 4 °C with lambda phosphatase (New England Biolabs), calf intestinal phosphatase (New England Biolabs) ...
-
bioRxiv - Genomics 2021Quote: ... Nicks were then ligated for 30 min at 37 °C using 4 units of Taq DNA ligase (NEB) in the presence of 0.5 μl thermopol buffer ...
-
bioRxiv - Immunology 2021Quote: ... into 384 well plates containing 0.5 µl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB), spun down and frozen at −80°C ...
-
bioRxiv - Biophysics 2020Quote: ... SecA(N95) K797C was overexpressed for 4 hours at 37 °C in E.coli NiCo21 cells (New England Biolabs) grown in 2xYT (Acumedia ...
-
bioRxiv - Molecular Biology 2023Quote: ... A mixture containing 1 μl of a 4-fold dilution of Low Range ssRNA Ladder (New England Biolabs) and 0.75 pmol each of RPIX_SC1_Bridge ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 and subjected to T7E1 digestion in a 20 ul reaction according to the manufacturer’s protocol (NEB cat.M0302). Digestion products were resolved on 8% acrylamide/bis TBE gel and visualized with EtBr.
-
bioRxiv - Microbiology 2023Quote: ... cDNAs and primers (listed in Table 4) were mixed with Luna Universal qPCR Master mix (New England Biolabs) and amplification was carried out in duplicate in a CFX96 Real-Time System C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Biophysics 2023Quote: ... The resulting 40 μl of reaction product was mixed with 4 μl of T5 Exonuclease (New England Biolabs) in NEB Buffer 4 ...
-
bioRxiv - Biochemistry 2023Quote: ... and a final concentration of 1.4 nM of hRNase 4 and 0.15 U/μL of polynucleotide kinase (New England Biolabs). The reactions were incubated at 37°C for 1 h and stopped by addition of murine RNase inhibitor to a final concentration of 2 U/μL and incubation at room temperature for 10 minutes ...
-
bioRxiv - Genetics 2023Quote: ... The ints-4 sgRNA was inserted into plasmid pDD162 via the Q5 Site-Directed Mutagenesis Kit (NEB, E0554S). The sgRNA plasmid and repair template were Sanger sequenced to confirm correct construct assembly followed by microinjection into EG9882 strain with integrated Cas9 activity (10 ng µl-1 repair template ...
-
bioRxiv - Microbiology 2023Quote: ... U6-del-F and U6-del-R (Supplementary table 4) were annealed and phosphorylated using T4 PNK (NEB) and ligated into the restricted plasmid using T7 DNA ligase ...
-
bioRxiv - Systems Biology 2024Quote: ... PLP ligation was performed for 4 hours at room temperature using 0.5 U/µl SplintR Ligase (NEB, M0375), 1x Ampligase ligase buffer ...
-
bioRxiv - Biophysics 2024Quote: ... A 4°C AKTA Pure FPLC system (Cytiva) was prepared with a 10 mL amylose column (NEB #E8021S) and 2 mL/min flow rate ...
-
bioRxiv - Neuroscience 2022Quote: ... 8 µl klenow polymerase (NEB M0210L) and 37.5 µl Biotin-14-dATP (Thermo 19524016 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 8 ul 5X HF buffer (NEB), 1 ul 25 uM library 1st round forward primer ...