Labshake search
Citations for New England Biolabs :
1151 - 1200 of 2939 citations for 4 Methoxy 6 methyl 6 phenyl 5H pyran 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... and then 2 μl of T7 Endonuclease (NEB) was added ...
-
bioRxiv - Genomics 2024Quote: ... and 2 μl of Phi29 DNA Polymerase (NEB). The reaction is incubated for 8 hours at 30°C.
-
bioRxiv - Bioengineering 2023Quote: ... and mRNA Cap 2’-O-methyltransferase (NEB, M0366S). Then ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µl T4-PNK (10 U/µl, NEB) and 9.5 µl H2OMQ were added ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μL of T4 DNA ligase (NEB M0202S) was added to the mixture and incubated overnight at room temperature to seal nicks on DNA ...
-
bioRxiv - Genomics 2022Quote: ... and 10 uL 2% BSA (New England Biolabs) for sample resuspension and dilution prior to 10x Genomics chip loading ...
-
bioRxiv - Genomics 2022Quote: ... 10 μL of 2% BSA (New England Biolabs), and 984 μL of nuclease-free water 1xST buffer was prepared by diluting 2x ST with ultrapure water (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL LongAmp Taq DNA Polymerase (NEB, # M0323L), 0.5 µM of each primer (First PCR F ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL LongAmp Taq DNA Polymerase (NEB, # M0323L), 0.5 µM of each primer (Second PCR F UMI ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL 10X NEB Buffer #2 (NEB #B7002S), 5 µL RppH (NEB #M0356S) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µM PNA,1X KAPA master mix (NEB) and 50 ng of template DNA ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 μl Taq DNA ligase (80 U, NEB), and 1 μl T4 DNA Polymerase (1 U ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 μl 10x Taq DNA Ligase buffer (NEB), 2 uL dNTP Solution Mix (10 mM stock ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 U of beta-agarose I (NEB, M0392), and 5 μL of Maxima H minus reverse transcriptase ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mM vanadyl-ribonucleoside (S1402S, New England Biolabs), and 15% formamide (60345 ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µL of Lambda Protein Phosphatase (NEB, P0753S) was added to aliquots 3 and 4 (PPase only) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 uL of T4 RNA Ligase Buffer (NEB) and 1 uL T4 RNA Ligase 2 (made in-house ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 µL of λ protein phosphatase (NEB P0753S) was added and incubated at 37°C for 30 minutes and then placed on ice ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... 10 µl 2× Gibson Assembly Master Mix (NEB)) ...
-
bioRxiv - Immunology 2024Quote: ... 2 uL of Rapid PNGase F Buffer (NEB) was added and incubated at 80°C for 3 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... Then 2 μL 10x RNA ligation buffer (NEB), 0.2 μL 100 mM ATP ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µL of 10X Thermo PCR buffer (NEB), 2 µL of ES-E14 wildtype cDNA template or from 1 µL plasmid pLJM1-EGFP for GFP esiRNAs ...
-
bioRxiv - Genomics 2024Quote: ... 2 µL of 10 mM ATP (NEB P0756S), 1 µL of E ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 μl RppH (NEB product number M0356S), followed by incubation at 37°C for 1 hr ...
-
Anti-HIV-1 Effect of the Fluoroquinolone Enoxacin and Modulation of Pro-viral hsa-miR-132 ProcessingbioRxiv - Molecular Biology 2024Quote: ... 10 units of T4 dsRNA Ligase 2 (NEB) were then added to the solution and incubated for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL 10X Exonuclease I reaction buffer (NEB), 13 µL water ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 units of T4 polynucleotide kinase (NEB, M0201S), 0.09 nM dNTPs and 0.045 μg/μL of BSA at 12°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µL of 10 mM ATP (NEB, #B0756AVIAL), 1 µL of E ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 U/mL yeast inorganic pyrophosphatase (NEB®) and 1000 U/mL murine RNase inhibitor (NEB®) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μl of Truncated T4 RNA Ligase (NEB), 1X ligation buffer (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... contained 2 μL ENDOIV (NEB, 10 U/µL), 1 μL BST DNA Polymerase FL (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µl of 20 mg/ml RNaseA (NEB) was added to the reaction and the reaction was incubated at room temperature for 5 minutes before quenching the reaction with 50 mM EDTA ...
-
bioRxiv - Biophysics 2024Quote: ... using T4 RNA ligase 2 (New England Biolabs).
-
bioRxiv - Biophysics 2024Quote: ... and HindIII (NEB, R3104S, 2 unit/μg DNA) of Plasmid pUC19 (NEB ...
-
bioRxiv - Genetics 2024Quote: ... containing 2 U of T5 exonuclease (NEB, M0363S), 12.5 U of Phusion DNA polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2024Quote: ... 2 kU of Taq DNA ligase (NEB, M0208S), 0.2 M Tris-HCl (pH 7.5) ...
-
bioRxiv - Biochemistry 2024Quote: ... 2) the NEBNext End Repair Module (NEB, E6050S) was used for repair of DNA ends after shearing ...
-
bioRxiv - Genomics 2024Quote: ... with 2% BSA and resuspended in NEB+ (NEB with 2% BSA ...
-
bioRxiv - Genomics 2024Quote: ... and 2 U Quick CIP (NEB, cat# M0525S) in digestion buffer (10 mM Tris ...
-
bioRxiv - Genetics 2023Quote: ... We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles, Tm 62 °C). We finally added dual indexing primers using the i5 and i7 system from Illumina (NEB Q5 for 20 cycles ...
-
bioRxiv - Genetics 2022Quote: ... The gRNA binding regions were checked for presence of single nucleotide polymorphism (SNP) by amplifying the region using One Taq 2X master mix (New England Biolabs, Ipswich, Massachusetts, USA) and subsequent sanger sequencing of the PCR product (primers designed by primer-BLAST ...
-
bioRxiv - Molecular Biology 2021Quote: ... One microgram of this PCR product and pKLV-U6gRNA(BbsI)-PGKpuro2ABFP was digested with MluI and BamHI (New England Biolabs, Ipswich, MA, USA). The digested products were purified ...
-
bioRxiv - Genomics 2022Quote: ... and one short read library using the NEBNext Ultra II FS DNA Library Kit for Illumina (New England BioLabs Inc., Ipswich, MA, USA). The long-read library was then sequenced on the PacBio Sequel IIe system in CLR mode using the Sequel II Binding Kit 2.2 (PacBio) ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 viral RNA detection and quantification was performed using the Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs, Whitby, ON, Canada) on the Rotor-gene Q platform (Qiagen) ...
-
bioRxiv - Genomics 2023Quote: ... The strain CBS 411.78-was prepared and sequenced with the ligation kit SQK108 in a one-pot reaction using 500 ng DNA for end prep and ligation (NEB Ultra-II ligase) and sequenced on an R9.4.1 flowcell ...
-
bioRxiv - Cell Biology 2024Quote: ... falciparum in placenta samples was evaluated using One Taq® Quick-Load® 2X Master Mix with Standard Buffer (NEB, Cat No. M0486L) and the following thermocycler program ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Then total RNA (500 ng per sample) was purified by one round of polyA mRNA selection with oligo-dT magnetic beads (NEB, Cat. No. S1550S), converted to cDNA using KAPA mRNA HyperPrep kit (KAPA biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... F: agaagtcttagcatatgtggtac R: aacagatgttggacccttcc RNA diluted at 1/100 was amplified using Luna® Universal One-Step RT-qPCR Kit (NEB, Ipswich, MA) according to the manufacturer’s directions on a QuantStudio3 (Applied Biosystems ...
-
bioRxiv - Neuroscience 2024Quote: ... Each reaction was performed in a 10 μL volume containing 1× Luna Universal One-Step Reaction Mix plus 1× Luna WarmStart® RT Enzyme Mix (Cat. No. E3005; New England BioLabs® Inc.), 0.4 µM of each primer and 2 µL of 10 ng/µL RNA ...
-
bioRxiv - Genomics 2024Quote: ... We employed the Luna Universal One-Step RT-qPCR Kit for the qPCR reactions (New England Biolabs, Ipswich, MA, USA, Catalog No. E3005). Each 20 μL reaction consisted of 10 μL reaction mix ...