Labshake search
Citations for New England Biolabs :
951 - 1000 of 2939 citations for 4 Methoxy 6 methyl 6 phenyl 5H pyran 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... We treated the crRNA with 4 U DNase I (NEB) to remove any remaining DNA templates for 15 minutes ...
-
Analysis of natural structures and chemical mapping data reveals local stability compensation in RNAbioRxiv - Biophysics 2024Quote: ... 4 μL of T7 RNA polymerase (New England Biolabs #M0251S), and 33 μL RNase-Free water ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4 μL of 10X T4 DNA ligase buffer (NEB). The thermocycling protocol was 30 cycles of 5 min digestion at 37°C and 5 min ligation at 16°C ...
-
bioRxiv - Microbiology 2020Quote: The real-time PCR technique was performed for NDV detection using Luna Universal One-Step RT-qPCR Kit E3005E (New England BioLabs, USA) following the manufacture procedures ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression of mRNA transcripts for PfRFC1 gene analysis were carried out using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Inc.), on a QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... A silent point-mutation was introduced to remove the BbsI recognition site within the blasticidin sequence to allow the subsequent insertion of one gRNA by SapI (NEB, R0569) cloning into the h7SK expression cassette and the second gRNA by BbsI (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... Total RNA preparations were then used directly for qPCR (200 ng total RNA per reaction) using the Luna Universal One-Step RT-qPCR Kit (NEB, E3006) and target-specific primer/probe sets (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was carried out using NEB Luna Universal Probe One-Step Reaction Mix and Enzyme Mix (New England Biolabs, Herts, UK), primers and probe at 500 nM and 127.5 nM ...
-
bioRxiv - Molecular Biology 2020Quote: ... Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs) using corresponding primers and probe (MS2_F ...
-
bioRxiv - Bioengineering 2021Quote: ... qRT-PCR was performed with primers specific for target genes (see Supplementary Table 1 for the list of primers) using the Luna universal One-Step RT-qPCR kit (NEB; E3005). Experiment was performed using the QuantStudio3 (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... qRTPCR was performed with primers mentioned in Table S3 with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs). Log2 normalized RNA abundances were calculated using ValidPrime signal as reference (51).
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed either directly on the inactivated supernatants or on extracted RNA using the Luna Universal One-Step RT-qPCR Kit (NEB #E3005E) in a QuantStudio 6 thermocycler (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 ng total RNA per 20 µl reaction were analyzed using the Luna Universal Probe One-Step RT-qPCR Kit (NEB, # E3006) in technical triplicates ...
-
bioRxiv - Molecular Biology 2022Quote: The rest of RNAs were performed with real-time reverse transcription PCR (RT-qPCR) using a Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs) according to the manufacturer’s recommendations by a thermocycler (BIO-RAD CFX96™ Real-Time System) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a total of 575 embryos were injected with a mixture containing 300 ng/μL of sgRNA (one guide) and 600 ng/μL of Cas9 protein (NEB, M0641) while for Dll ...
-
bioRxiv - Plant Biology 2022Quote: ... and LCM cell sample collections (ME, TAP, and OSC) was performed using the Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs). Quantitative PCR was performed using TaqMan primers synthesized by Integrated DNA Technologies (Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... Quantification of the replication of each mutant versus the reference was performed using Luna® Universal Probe One-Step RT-qPCR kit (New England BioLabs) containing 3uL of total RNA ...
-
bioRxiv - Microbiology 2022Quote: ... One-step quantitative RT-PCR was used to determine gene expression levels using the Luna Universal One-Step RT-qPCR kit (New England Biolabs Inc.) according to the manufacturer’s recommendations using 4 ng of total RNA per 20µl reaction ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR reactions were carried out using LightCycler 96 instrument and following reagents: Luna Universal One-Step RT-qPCR Kit (New England Biolabs, NEB) for hCoV-229E and hCoV-OC43 ...
-
bioRxiv - Cell Biology 2020Quote: ... 200 ng/μL was used for subsequent reverse transcription assay with Luna® Universal One Step RT-qPCR kit (E3005, New England Biolabs) according manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Biochemistry 2022Quote: ... Deglycosylation was performed using Peptide-N-Glycosidase F (PNGase F) at 37 °C for one hour according to the supplier’s protocol (New England Biolabs, Hitchin, UK). Enzyme purity and molecular weight were estimated by 12 % SDS-PAGE using mini-PROTEAN 3 system (BioRad ...
-
bioRxiv - Microbiology 2022Quote: ... 1-step RT-qPCR was performed on 2μL of RNA using the Luna® Universal One-Step RT-qPCR Kit (NEB Biosciences) and primers for β-tubulin (F ...
-
bioRxiv - Genomics 2022Quote: ... The incomplete ligation product (fragment having only one or no adaptor ligated) was removed using exonuclease (NEB ExoIII and NEB ExoVII). Two nick sites were created at the Uracil positions in the hairpin adapters at both ends after being treated with UDG (NEB ...
-
bioRxiv - Genomics 2022Quote: ... The incomplete ligation product (fragment having only one or no adaptor ligated) was removed using exonuclease (NEB ExoIII and NEB ExoVII). Two nick sites were created at the Uracil positions in the hairpin adapters at both ends after being treated with UDG (NEB ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... One µg of total RNA was used for the NEBNext® Ultra™ Directional RNA Library Prep Kit (New England Biolabs) without removing ribosomal RNA ...
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR reactions were carried out in 10 μL reactions using the Luna® One-Step Universal RT-qPCR kit (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... and the pHW2000 plasmid backbone such that the whole plasmid could be assembled in a one-pot golden gate reaction with PaqCI (NEB, #R0745S). Due to repeated regions ...
-
bioRxiv - Microbiology 2023Quote: ... were assembled by hybridisation of complementary oligonucleotides with one oligonucleotide being radiolabelled with [γ-32P]-ATP by T4 polynucleotide kinase (NEB). 15 µl EMSA samples contained 800 pM DNA template ...
-
bioRxiv - Biochemistry 2022Quote: ... Deglycosylation was performed using Peptide-N-Glycosidase F (PNGase F) at 37 °C for one hour according to the supplier’s protocol (New England Biolabs, Hitchin, UK). Enzyme purity and molecular weight were estimated using a 12% SDS-PAGE and mini-PROTEAN 3 system (BioRad ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was diluted 1:50 for RT-qPCR which was conducted using the Luna Universal One-Step RT-qPCR kit (New England Biolabs E3005E) on a C1000 touch thermal Cycler / CFX384 Real-Time System (Biorad) ...
-
bioRxiv - Microbiology 2023Quote: RNA was used as template to detect and quantify viral genomes by duplex reverse transcriptase (RT) quantitative polymerase chain reaction (RT-qPCR) using a Luna Universal Probe one-step RT-qPCR kit (New England Biolabs, E3006E). SARS-CoV-2-specific RNAs were detected by targeting the ORF1ab gene using the following set of primers and probes ...
-
bioRxiv - Genomics 2022Quote: ... mScarlet and HPRT (housekeeping gene for normalization) levels were then measured by qPCR using the Luna Universal One-Step RT-qPCR Kit (NEB #E3005) with 100ng total RNA per reaction ...
-
bioRxiv - Microbiology 2023Quote: ... Region of Cori and ter were quantitatively amplified using the Sybr green-based Luna Universal One-step RT-qPCR kit (New England Biolabs Inc.), without the reverse transcriptase enzyme ...
-
bioRxiv - Molecular Biology 2023Quote: ... Each sample for resection analysis was divided into two aliquots and one aliquot was digested with the Sty-I-HF (NEB, R3500S) restriction enzyme ...
-
bioRxiv - Biochemistry 2024Quote: The pET15b-CtTrl1-LIG plasmid22 served as template for PCR-based site direct mutagenesis with one oligonucleotide for K148N and E328-stop (ΔCTD) variants or two oligonucleotides and Q5® Site-Directed Mutagenesis Kit (NEB) to introduce R334A ...
-
bioRxiv - Developmental Biology 2024Quote: ... 500 ng total RNA was used as template with the Luna Universal One-step RT-qPCR kit (New England Biolabs, E3005L). For each condition 3 biological replicates with two technical replicate RT-qPCR reactions were run on a CFX96 Connect Real-Time System (BioRad) ...
-
bioRxiv - Plant Biology 2024Quote: ... Assembly reactions were performed by a one-pot mixture that consists of Type II restriction enzymes with T4 DNA ligase (NEB, USA) as described in Sauret-Gueto et al ...
-
bioRxiv - Systems Biology 2024Quote: ... 10 ng nuclear RNA and 100 ng whole-cell RNA was used as template for RT-qPCR using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005). PCR was performed per manufacturer recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... and cloned into pMOTag2T already containing a puromycin resistance marker and one copy of the Ty1 tag (63) by XhoI site using NEBuilder® HiFi DNA Assembly cloning kit (New England Biolabs). The Donor DNA provided to induce homology-directed repair contained a 3x-Ty1 tag ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 µM of one of the following indexed reverse primer (aatgatacggcgaccaccgagatctacactcgtggagcgagcacaaaaggaaactcaccctaactgt, aatgatacggcgaccaccgagatctacacctacaagataagcacaaaaggaaactcaccctaactgt, aatgatacggcgaccaccgagatctacactatagtagctagcacaaaaggaaactcaccctaactgt, aatgatacggcgaccaccgagatctacactgcctggtggagcacaaaaggaaactcaccctaactgt) and 1x NEBNext Ultra Q5 MasterMix (NEB M0544L). Cycling parameters were as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... The qRT-PCR assay was performed using 500 ng of total RNA and the Luna Universal One-Step RT-qPCR Kit (NEB, E3005S) on a QuantStudio 3 system (Applied Biosystems) ...
-
bioRxiv - Immunology 2024Quote: ... Primers for each were designed from PrimerBank for mouse and qRT-PCR was performed as a one step Sybr Green reaction using Luna kits (NEB, MA)
-
bioRxiv - Cell Biology 2024Quote: ... and RPL5 mRNA knockdown efficiency were assayed by real-time quantitative reverse-transcription PCR (RT-qPCR) using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... the synthesis of biotin labeled probes was conducted by PCR in a 50 µl reaction volume with one Taq® standard reaction buffer (Biolabs), 0.2 mM dNTPs where dCTP ...
-
bioRxiv - Developmental Biology 2024Quote: ... OLIG2::HA::SNAP cells were incubated for one hour in RA and SAG medium containing 100 nM SNAP-Cell 647-SiR ligand (NEB S9102S). After two PBS washes ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein Phosphatase Inhibitor 2 (New England Biolabs) and Trichostatin A HDAC inhibitor (TSA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl 10 mM ATP (NEB, 0756), 1 µl 100 mM DTT (Cell Signaling Technology Europe ...
-
bioRxiv - Cell Biology 2020Quote: ... in 1x glycobuffer 2 (New England Biolabs), and 10% NP-40 (New England Biolabs ...