Labshake search
Citations for New England Biolabs :
1051 - 1100 of 1332 citations for 3 Thiophen 3 yl benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 3’ homozygous arm was amplified from y,sc,v genomic DNA using Q5 High-Fidelity DNA Polymerase (New England BioLabs, NEB) with primers ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... All genomic insertions were targeted to the 3’ end of the glmS gene of ICC8001 and all constructs were generated by Gibson Assembly (New England Biolabs, US).
-
bioRxiv - Microbiology 2021Quote: ... was ligated with the digested vector in a ratio of 3:1 using the Gibson assembly ligation matrix mix (NEB E5510S). Each ligation reaction was incubated for 1 hour at 50 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 DNA fragments were generated with PCR from genomic DNA or plasmids using Q5 High-Fidelity DNA Polymerase (NEB Cat# M0491). Fragment 1 included the genomic DNA between guide 1 and the KI site plus flipped guide 2 (with PAM ...
-
bioRxiv - Molecular Biology 2021Quote: ... Pre-miRNAs were purified on denaturant polyacrylamide gel and long pri-miR-K10/12 derived transcripts (up to ∼3 kb) were salt purified using Monarch® PCR and DNA cleanup kit (New England BioLabs). After acidic phenol extraction and ethanol precipitation ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...
-
bioRxiv - Biochemistry 2022Quote: ... Linearised plasmid was mixed with 2-3-fold excess of the three insert fragments followed by addition of Gibson Assembly® Master Mix (New England Biolabs) and incubation at 50°C for 60 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... The 3’ends of end-repaired DNA were extended with an A-overhang with 3’ to 5’ exonuclease-deficient Klenow DNA polymerase (NEB, M0212L). The resulting fragments were ligated to Nextflex 6bp adaptors (Bio Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3′ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L). Linker-ligated footprints were reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... and BGH reverse (5’-TAG AAG GCA CAG TCG AGG -3’) primers from the pcDNA3.1+/-C-(K)-D vector using standard methods (NEB 2x Q5) which include 5-10 ng DNA per reaction ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA template for the assay was generated by annealing a primer (5′-CCCAGTCACGACGTTGTAAAACG-3′) to M13mp18 single-stranded DNA (New England Biolabs, N4040S). The assay was initiated by incubation of 1nM of DNA template with 1 mM ATP ...
-
bioRxiv - Evolutionary Biology 2022Quote: pBGC24 was used to construct pBGA by exchanging the cat gene (chloramphenicol resistance) with aac(3)-IV (apramycin resistance) from pMDIAI31 by Gibson assembly (New England Biolabs, UK). pLC10-Apra was constructed by exchanging the aph(3’)-Ia gene (Kanamycin resistance ...
-
bioRxiv - Molecular Biology 2020Quote: ... where 200pmol 5’-adenylated,3-dideoxyC DNA adapters (Table 1) were ligated with 400U truncated T4 RNA ligase 2 (NEB M0242) in 1X ATP-free T4 RNA ligase buffer [50mM Tris pH 7.5 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 0.5-1.0 μg of genomic DNA for each sample was heated at 65°C for 2-3 hours prior to digestion with PstI (New England Biolabs, UK). This enzyme has a 6 bp recognition site and leaves a 4 bp overhang ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting amplicon was assembled with a hHBB-Nluc sequence that lacked a 3’ UTR but maintained a unique barcode using a NEBuilder HiFi Assembly Kit (NEB, ES2621).
-
bioRxiv - Cell Biology 2020Quote: Three point mutations in the predicted miR-145 seed binding site in DUSP6 were introduced in pGEM-T-DUSP6 3’UTR using a Phusion® site-directed mutagenesis kit (NEB) and the mutagenic primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μl of RNA were mixed with 2 μl of 100 μM PvG748-SBS12-RT random hexamer primer (Supplementary Table 3) and 1 μl of 10 mM dNTP mix (NEB, N0447S), incubated for 3 minutes at 65 °C and transferred to ice ...
-
bioRxiv - Synthetic Biology 2021Quote: 8.3 μM bdSUMO-HSPB611–20 fusion protein containing pSer or nhpSer at site S16 of HSPB6 were reacted with 3 units of λ phosphatase (NEB) according to manufacturer’s guidelines ...
-
bioRxiv - Genetics 2021Quote: ... the RNP complex was assembled by incubating 9 μL of guide RNA with 3 μL of nuclease in 12 μL of nuclease-free H2O with 3 μL of 10x Cas9 reaction buffer (New England Biolabs, #B0386) at 37 °C for 15 minutes ...
-
bioRxiv - Genomics 2021Quote: ... DNA samples were incubated with 50 μM dATP and 5 U of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212) in 30 μl 1 × NEBuffer2 at 37°C for 30 minutes.
-
bioRxiv - Microbiology 2021Quote: ... and ChCEC6 were amplified using primers listed in Supplementary Table 3 and Phusion® High-Fidelity DNA Polymerase (New England Biolabs), then cloned into pCR8/GW/TOPO (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L). Linker-ligated footprints were reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... Digestion into nucleosides was carried out on 3 μg aliquots using ‘nucleoside digestion enzyme mix’ from New England Biolabs (NEB#M0649) and incubated overnight at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The Sox2 promoter was cloned by first removing the Ef1a promoter from the 3-SB-EF1-PBBAR-SB vector using NdeI (NEB, R0111) and SalI (NEB ...
-
bioRxiv - Immunology 2020Quote: mRNA capping reaction was performed with purified IVT mRNA using 3’-O-Me-m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB, USA). The reaction condition was followed according to supplier’s manual ...
-
bioRxiv - Molecular Biology 2020Quote: ... was linked to the free hydroxyl group at the 3’-end of transcripts (1 □g of total RNA) by T4 RNA ligase 1 (NEB M0204) in the presence of 15% (w/v ...
-
bioRxiv - Cell Biology 2022Quote: ... TSF-ATG101:ATG13 (1-197) complex (final 3 μM) were incubated with 30 μl Amylose resin (New England Biolabs, Ipswich, MA) at 4 °C overnight in the ITC buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were washed 3 times with PBS and permeabilized 5 min on ice with permeabilize sol (1xPBS, 1%RNAse inhibitor Ribovanadylcomplex (RVC, NEB,#S1402S), 0,5 % Triton X-100 (Sigma ...
-
bioRxiv - Genomics 2022Quote: ... blunt DNA fragments on the beads were adenine-tailed by adding 7μl of Klenow 3’→5’ exo-polymerase 5U/μl (New England Biolabs cat. #M0212L), 2.3μl of dATP 10mM and 5 μl NEB2 of 10x NEBuffer 2 and incubating the mixture 30 minutes at 37ºC and a further 10 minutes at 65ºC to inactivate the enzyme.
-
bioRxiv - Genomics 2022Quote: ... The RNA was removed from beads by Trizol and then followed with the 3’ adapter ligation using T4 RNA Ligase 1 (NEB M0204L). After this ...
-
bioRxiv - Genomics 2022Quote: ... the SapI sgRNA expression cassette was ligated into the KpnI linearized PX458 in a 3:1 molarity ratio using T4 DNA-ligase (New England Biolabs, M0202S) according to the manufacturer’s instructions followed by transformation and Sanger sequencing to verify successful cloning ...
-
bioRxiv - Genomics 2022Quote: ... PX458 and the synthetized SapI sgRNA expression cassette (IDT, find sequence in Table 3) were digested with KpnI (New England Biolabs, R3142S). Next ...
-
bioRxiv - Microbiology 2022Quote: ... Assembly of the two cDNA fragments was done using five overlapping cDNA fragments containing the VOC lineage defining mutations and replicon specific gene replacements (see Supplementary Table 3) using a NEBuilder® HiFi DNA Assembly Master Mix (NEB) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting double-stranded oligos had 5’ extensions that were complementary to the non-palindromic 3’ overhangs generated by BsaI-HFv2 (NEB, R3733) digestion of pJJW101 ...
-
bioRxiv - Neuroscience 2022Quote: ... and pre-amplified for 14 cycles against a pool of primers (Supplemental Table 3) using PreAmp Grandmaster mix (TATAA Biocenter, Sweden #TA05) before exonuclease I treatment (New England Biolabs #M0293L). Pre-amplified cDNA was diluted at least 5-fold with nuclease-free water and mixed with SsoFast EvaGreen with Low ROX (BioRad #1725211 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction underwent ethanol precipitation as described above and the precipitated DNA was suspended in 32 μl Elution buffer and used in a 50 μl A-tailing reaction using Klenow (3’→5’ exo-) (NEB, M0212), incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transcribed into mRNA which was co-transcriptionally capped with the Anti-Reverse Cap Analog (ARCA) 3′-O-Me-m7G(5′)ppp(5′)G (NEB # S1411) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) ...
-
bioRxiv - Genomics 2022Quote: ... Looped adapter sequences were opened by removal of uracil from hairpin structures by adding 3 units of USER enzyme (Uracil-Specific Excision Reagent) (NEB, M5505S) and incubation at 37 °C for 15 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The ligation was performed at a 3:1 insert-to-vector ratio and by using T4 DNA ligase (New England Biolabs, USA) for 16 hours at 16 °C according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... and PE 2.0 (5′-CAA GCA GAA GAC GGC ATA CGA GAT CGG TCT CGG CAT TCC TGC TGA ACC GCT CTT CCG ATC* T-3′) for 15 cycles using Phusion polymerase (NEB M0530S). The library was purified by electrophoresis on a 1.2% agarose gel to get rid of adapter dimers ...
-
bioRxiv - Molecular Biology 2023Quote: Internally fluorescein-labelled RNA was produced by ligation of in vitro transcribed 5′ acceptor RNA fragment with chemically produced 3′ donor RNA containing internal fluorescein dT modification and 5′ monophosphate essential for ligase activity using T4 Ligase 2 (NEB #M0239S). Additionally ...
-
bioRxiv - Cell Biology 2024Quote: ... were obtained from HeLa cells co-transfected with mGFP-Sec16L at 3 µg/µL and FLAG-TFG-SNAP at 1 µg/µL and subsequently labeled with SNAP-Cell 647-SiR (NEB, S9102S) and immunostained with anti-GM130 ...
-
bioRxiv - Cell Biology 2024Quote: ... The pRNA destination backbone was linearised by primers s5 and s6 (Table 3) and assembled with the mScarlet-I3 fragment using a NEBuilder® HiFi DNA Assembly kit (NEB) to create a pRNA-mScarlet-I3 destination vector ...
-
bioRxiv - Cell Biology 2024Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA ligase 2 truncated KQ (NEB, M0373L). Linker-ligated RNA was reverse transcribed with Protoscript II (NEB ...
-
bioRxiv - Genomics 2023Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L).
-
bioRxiv - Microbiology 2022Quote: ... 8 candidate Envs containing variations of signature mutations were synthesized by Synbio Technologies and were cloned into the SHIV.3C backbone using the BsmBI restriction sites at the 5’ and 3’ end of the CH505 Env cassette and then ligated together using T4 ligase (New England Biolabs #M0202S). 8 plasmids encoding full-length SHIV.C.CH505 combination clones were used to transfect 293T cells as described above ...
-
bioRxiv - Molecular Biology 2023Quote: ... barcoded 5’ -pre-adenylated linkers were added to the 3’ ends of footprints using T4 Rnl2(tr) K227Q (New England Biolabs, M0351S), and excess unligated linker was removed using 10 U/µl 5’ deadenylase/RecJ exonuclease (Epicentre ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total of 3 μg RNA was prepared for sequencing libraries using the NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB, USA) according to manufacturer’s instructions and sequences attributed to each sample by adding index codes ...
-
bioRxiv - Biochemistry 2023Quote: ... and ATF4 5ʹ UTR-nLuc-3XFLAG mRNAs were co-transcriptionally capped with the 3’-O-Me-m7G(5ʹ)ppp(5ʹ)G RNA Cap Structure Analog (NEB # S1411S). All viral IRES nLuc-3XFLAG mRNAs were co-transcriptionally capped with the A(5ʹ)ppp(5ʹ)G RNA Cap Structure Analog (NEB # S1406S).