Labshake search
Citations for New England Biolabs :
1001 - 1050 of 1332 citations for 3 Thiophen 3 yl benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Purified extension products were denatured and ligated to adaptor 2 (Ad2, Supplementary Table 3) by Instant Sticky-end Ligase Master Mix (New England Biolabs) at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... primer O3P (Supplementary Table 3) was attached to IP-purified DNA and was extended by NEBNext Ultra II Q5 Master Mix (New England Biolabs), followed by ExoI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and then adenylated at the 5′ end with a 5′ DNA adenylation kit (NEB). Four random nucleotides were added in the 3′ and 5′ adapters [(5′ -rAppNNNNTGGAATTCTCGGGTGCCAAGG/amino CA linker-3′ ...
-
bioRxiv - Molecular Biology 2024Quote: ... A second adapter was then ligated to the 3’OH of the cDNAs (with NEB HC RNA Ligase in NEB ligation buffer plus 5% DMSO ...
-
bioRxiv - Molecular Biology 2024Quote: ... The oligonucleotide-based DNA substrate used for the helicase and nuclease assays was generated by labeling the BIO100C oligonucleotide (see Table S1 for oligonucleotides sequence) at the 3’ end using terminal transferase (New England Biolabs) and [α-32P]dCTP (Hartmann Analytic ...
-
bioRxiv - Developmental Biology 2024Quote: ... along with 5 ng/μl Pmyo-3::GFP and 20 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate the DLS344 strain ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 15 µl of anti-MBP couped beads (pre-blocked for 1h in RIPA with 3 % BSA; NEB) for 2 h ...
-
bioRxiv - Cell Biology 2024Quote: ... The inserts and the backbone were mixed in a 3:1 ratio and incubated with the 2x NEBuilder HiFi DNA assembly enzyme mix (New England Biolabs) for 1h at 50°C ...
-
bioRxiv - Cell Biology 2024Quote: ... the newly produced CENP-A-SNAP pool was labelled by exposing the mitotic cells to media containing 3 µM SNAP-Cell 647 (NEB) and 5 µM STLC (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: Libraries of immunoprecipitated DNA were generated from 3 ng of starting DNA with the NEBNext Ultra DNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions at the CRG Genomics Core Facility (Barcelona ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using a 5′ DNA adenylation kit at the 5′ end (NEB). To reduce ligation bias ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the radiolabeled 3’ fragment was ligated to an unlabeled 5’ fragment by splinted ligation with T4 DNA ligase (NEB) at 30°C for 2 h ...
-
bioRxiv - Cell Biology 2024Quote: ... we microinjected 5 ng/μl Pmyo-3::GFP and 95 ng/μl of 2-Log DNA ladder (New England BioLabs) into the germline of GRD-3::mKate2 animals to generate transgenics expressing a muscle-specific GFP marker.
-
bioRxiv - Genomics 2024Quote: ... The backbones for the Gibson reaction for GRB2-SH3 and PSD95-PDZ3 library assembly (aPCA plasmids) were first linearized using primers listed in Extended Data Table 3 and next treated with Dpn1 (NEB) restriction enzyme to remove the circular plasmid template ...
-
bioRxiv - Biochemistry 2024Quote: ... and ligated to a preadenylated oligonucleotide linker (NI-816: 5’-/5Phos/NNNNNTAGACAGATCGGAAGAGCACACGTCTGAA/3ddC/-3’) using T4 RNA Ligase 2 truncated KQ (NEB). Unligated linker was depleted by treatment with yeast 5’-deadenylase (NEB ...
-
bioRxiv - Genetics 2024Quote: ... amplified with outside primers corresponding to the 5’ constant sequence and the reverse complement of the 3’ constant sequence in 17 cycles using Phusion Polymerase (New England Biolabs), and then inserted into BbsI-digested pLib6.6 using the NEB HiFi Assembly Master Mix Library.The reaction was electroporated into E ...
-
bioRxiv - Microbiology 2024Quote: ... 5’ pir-2 flank::PtrpC::nat::3’ pir-2 flank assembly was constructed using NEBuilder Assembly Kit (New England Biolabs). Each assembly fragment was either synthesized (T4 Oligo ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was isolated from frozen hDRG tissue and GBP- or vehicle-treated primary hDRG cultures (n = 3 per condition) using the Monarch Total RNA Miniprep Kit (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... A deoxycytidine homopolymer tail (C-tail) was added to the 3’ end of the linear extension products using terminal deoxynucleotidyl transferase (TdT; New England Biolabs). The reaction was carried out at 37 °C for 1 hour ...
-
bioRxiv - Microbiology 2024Quote: ... and nCoV_IP4-14084 Probe(+)TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as PFU equivalents (eqPFU ...
-
bioRxiv - Genetics 2024Quote: ... containing a T-overhang for the 5’ and 3’ ends of the fragments were ligated to the fragments using TA-ligation with the Quick Ligation Kit (NEB, M2200L ...
-
bioRxiv - Biophysics 2024Quote: ... We combined the plasmid backbone with the colony PCR insert by mixing them in molar ratio 1:3 in the 2xHiFi mix (New England Biolabs) to obtain the final plasmid of 4175 bp ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 ug of plasmid was digested in a 3X restriction enzyme reaction containing 15 uL Digestion rCutSmart Buffer (NEB, B6004), 3 µL BsiWI-HF (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... The variant library was ligated into each vector with a 1:3 (insert: vector) T4 ligation at 16°C overnight (NEB). Ligations were DNA cleaned (Zymo) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then ligated to the 3’ end of the cDNA by using Thermostable 5’ App DNA/RNA Ligase (New England Biolabs) for 2 h at 65°C ...
-
bioRxiv - Biophysics 2024Quote: ... A 30 nt 3′ overhang was created by treating the purified PCR product with USER enzyme mix (NEB, Cat# M5505S) for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 1.5 ml fractions of the protein pool were incubated with 3-fold molar excess of SNAP-Surface Alexa Fluor 546 or SNAP-Surface Alexa Fluor 647 (New England Biolabs) overnight at 4 °C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Illumina sequencing libraries were prepared by amplifying 50 µL of each cDNA sample with sequencing adapters (500 nM each library amplification primer, Supplementary Table 3) using the NEBNext Q5 High Fidelity 2x PCR Kit (NEB) under the following cycling conditions ...
-
bioRxiv - Bioengineering 2024Quote: ... Five ligation reactions (20 µL each) were set up using 100 ng DNA (3:1 ratio of library to backbone) and T4 ligase (NEB). Ligation occurred at room temperature for 30 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... and the digested fragments were mixed in a proportion of 3:1 in the presence of T4 DNA Ligase (New England Biolabs) to obtain the PP1α87B coding sequence in frame with N-terminal EGFP under the regulation of a metallothionein promoter (pMT-EGFP-PP1α87BWT) ...
-
bioRxiv - Biochemistry 2024Quote: Cas13a Alcr open reading frames were amplified with T7 forward and reverse primers (Supplementary Table 3) using 2X Q5 polymerase Master Mix (NEB) and purified with QiaQuick PCR clean up (Qiagen) ...
-
bioRxiv - Biochemistry 2024Quote: ... either at the 5’ or 3’ of the trimerization domain and then inserted into a pET29b+ vector using PaqCI (NEB). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... RA2 reverse primer 5’-GAGTCGTTCGAATTCTTATGAGTCCGCCGGACGTCTCCGCA CATG-3’) and sub-cloned into pET28 (MilliporeSigma) using Nde1 and EcoR1 restriction enzymes and T4 DNA ligase (New England Biolabs). Similarly ...
-
bioRxiv - Genomics 2021Quote: ... and washed 3 times with ice-cold 10 mM Ribonucleoside Vanadyl Complex (RVC) (New England BioLabs, cat.no. S1402S, Ipswich, Mass, USA) in buffer A (10 mM NaCl ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3’UTRs were combined to the TagRFP-T CDS using the Gibson assembly Master Mix (Cat#E2611, New England BioLabs Inc). The resulting fragment was then amplified via PCR and digested prior ligation into a vector containing only Hofstenia promoter region ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid was linearized with SacI or XhoI (for transcription from T7 or SP6 promoter respectively) and 3’UTR fragment was transcribed in vitro using SP6 or T7 polymerases (New England Biolabs, UK) and the DIG RNA labelling Mix (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA probes were complimentary to the 3′-UTR regions immediately adjacent to the poly(A) tails and were labeled with T4 PNK (NEB, M0201S) and [γ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Cell Biology 2022Quote: ... 200 pmol of an equimolar mixture of all gene-specific oligos for each gene were mixed with 250 pmol of the appropriate FLAP oligo in 1x NEBuffer 3 (New England Biolabs, B7003), then incubated in a Thermocycler (BioRad ...
-
bioRxiv - Genomics 2022Quote: ... an adenylated 5’ end and a dideoxycytosine blocked 3’end – was ligated to size-selected small RNAs using T4 Rnl2tr K227Q (NEB, M0351L) for 16 hours at 25°C ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product and pGAD-C1 vector were digested with ClaI (5’-ATCGAT-3’, New England BioLabs Inc., MA, CA#R0197S) and SalI (5’-GTCGAC-3’ ...
-
bioRxiv - Genomics 2021Quote: Capping with 3’ Desthiobiotin GTP (DTB-GTP) was performed in 50 µl total volume with 5 µL Vaccinia capping enzyme (NEB M02080) and 0.5 mM DTB-GTP (NEB N0761) ...
-
bioRxiv - Microbiology 2021Quote: ... the SAG1 3’UTR was amplified from pNJ-26 and cloned into the tagging plasmid to replace DHFR 3’UTR by Gibson assembly (NEB, E5520S). BAG1-mCherry GCaMP6f reporter tachyzoites were co-transfected with 10 μg of pSAG1::CAS9-U6::sgDHFR 3’UTR and 2 μg of PCR amplified P2A-mTagBFP2-HXGPRT flanked with 40 bp homology regions ...
-
bioRxiv - Cell Biology 2021Quote: ... The library was PCR amplified using universal primers that annealed to the common flanking sequence and appended homologous sequences at 5’ and 3’ ends of the PCR product to enable Gibson assembly (New England Biolabs E2611) into pZLCv2_puro_1KF ...
-
bioRxiv - Neuroscience 2020Quote: Overlapping fragments of the unstable NaV1.1 cassette-3 were amplified in polymerase chain reactions (PCR) using Q5® Hot Start High Fidelity 2x Master mix (New England Biolabs) and the primer pairs listed in Table S1 ...