Labshake search
Citations for New England Biolabs :
1001 - 1050 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2021Quote: Plasmids were linearised by restriction digest and purified using Monarch PCR and DNA Clean-up Kit (NEB, USA). 3’UTRs were in vitro transcribed from 1μg of linearised plasmids using MEGAscript T7 Transcription Kit (Invitrogen ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: ... Bands were extracted for subsequent amplification as above and purification using a Monarch PCR Cleanup Kit (NEB T1030L). Purified products were sequenced commercially (ACGT ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... The synthesized ssDNA was purified using a Monarch PCR & DNA Cleanup Kit (New England Biolabs, Ipswich, MA, USA) and was eluted in ultrapure water ...
-
bioRxiv - Genetics 2022Quote: ... PCR-products were gel purified after agarose gel electrophoresis with Monarch DNA Gel Extraction Kit (New England Biolabs) and submitted for sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR amplicon libraries were generated using NEBNext Ultra II DNA library prep kit following the manufacturer’s protocol (NEB), and sequenced on an Illumina NextSeq500 system using the 75bp high output sequencing kit ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Site-directed mutagenesis of DmelOrco was done by PCR with the Q5® site directed mutagenesis kit (NEB) using primers optimized with the NEBase Changer online tool and following the supplier’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... the products of PCR1 were purified using the Monarch PCR & DNA Cleanup Kit (New England Biolabs, no. T1030L) and deep sequenced at the MGH DNA Core ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 25 mM EDTA followed by clean-up with a Monarch PCR & DNA Cleanup Kit (New England Biolabs). Second-strand DNA synthesis was done by ligating 10 µM of a blunt-end duplex comprised of a 32-bp Illumina R1-3’SpC3 and 5’-phosphorylated R1R-3’SpC3 DNA (pre-annealed by incubating at 95°C for 3 min and slowly cooling to 25°C ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were purified after agarose gel electrophoresis using the Monarch DNA Gel Extraction Kit (New England Biolabs) and submitted for Sanger sequencing to Eurofins Genomics ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA or genomic sequence of each gene was amplified by Phusion High-Fidelity PCR kit (New England BioLabs), cloned to pDonor 221 ...
-
bioRxiv - Plant Biology 2023Quote: ... Amplified PCR products with appropriate expected sizes were purified with the Monarch® DNA Gel Extraction Kit (NEB). Purified PCR products were cloned into the pMiniT 2.0 vector (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... Hep3B cells and HBV control HepG2 2.2.15 cells and subjected to PCR amplification using the LongAmp Taq kit (NEB) and HBV primers spanning the CTCF binding motifs (HBV2 forward and Hep23B reverse) ...
-
bioRxiv - Genomics 2023Quote: ... Psoralen pull-down DNA was further purified using a Monarch PCR & DNA clean-up kit (New England Biolabs), eluted in 15 μl of EB buffer (10 mM Tris ...
-
bioRxiv - Microbiology 2023Quote: ... We generated sequencing libraries using the TruSeq DNA PCR-Free Sample Preparation Kit (New England Biolabs, Massachusetts, USA), which were sequenced using the Illumina MiSeq PE300 platform (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... non incorporated primers were removed using the Monarch PCR and DNA clean up kit (New England Biolabs, T1030), using a binding buffer ratio to DNA of 3:1 ...
-
bioRxiv - Microbiology 2024Quote: ... The two PCR products were extracted and assembled using the NEBuilder HiFi DNA Assembly kit (New England Biolabs). The assembly product was transformed into E ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1 μl ProtoScript II RT (200 U/μl, New England Biolabs) to a total volume of 20 μl ...
-
bioRxiv - Cancer Biology 2022Quote: ... and reverse transcription performed using LunaScript RT SuperMix (E3010, New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 μg RNA was converted into cDNA using ProtoScript II RT (NEB), oligo(dT)s and Murine RNAse inhibitor (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-qPCR (Luna® Universal qPCR Master Mix; New England BioLabs; M3003L) was performed in 384-well plates (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 µL of Template Switching RT Enzyme Mix (NEB Catalog# M0466L). After mixing ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCRs were performed using Luna® Universal qPCR Master Mix (NEB) and acquired on a QuantStudio 3 system (Applied Biosystems ...
-
bioRxiv - Biochemistry 2023Quote: ... Luna Probe One-Step RT-qPCR 4X Mix with UDG (NEB M3019) or the Luna Universal Probe One-Step RT-qPCR Kit (NEB E3006 ...
-
bioRxiv - Biochemistry 2023Quote: ... RT-qPCR was performed using the Luna Universal qPCR Master Mix (NEB) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: cDNA conversion was performed using ProtoScript II RT standard protocol (NEB, #M0368) and Random Primer Mix (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed using Luna Universal qPCR Master mix (NEB #M3003) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and Luna Probe One-Step RT-qPCR 4X Mix with UDG (NEB) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: Reverse transcription was done using DNase-treated RNA using MMLV RT (NEB) according to the manufacture protocol ...
-
bioRxiv - Immunology 2023Quote: ... Reverse transcription was carried out using LunaScript RT (New England Biolabs E3010) per manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... In total 27 libraries (3 species x 9 time points) were prepared according to NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, U.S.A.) followed by paired end sequencing (100bp x 2 ...
-
bioRxiv - Molecular Biology 2019Quote: PCR products were amplified by PCR using the Q5 (NEB®) high-fidelity polymerase following standard conditions ...
-
bioRxiv - Molecular Biology 2023Quote: All restriction enzymes were purchased from NEB and PCR amplification was performed with Q5 High-Fidelity PCR (NEB) following the manufacturer’s recommendations ...
-
A modular circuit architecture coordinates the diversification of courtship strategies in DrosophilabioRxiv - Neuroscience 2023Quote: ... were PCR amplified using Phusion High-Fidelity PCR Master Mix (NEB) and cloned into pCFD4 (Addgene 49411 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... PCR were performed using Q5 PCR master mix and One-Taq quick load master mix for colony PCR (NEB), primers were purchased from IDT (Louvain ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR were performed using Q5 PCR master mix and One-Taq quick load master mix for colony PCR (NEB), primers were purchased from IDT (Louvain ...
-
bioRxiv - Developmental Biology 2021Quote: ... and PCR addition of indices (7-11 cycles) was done using NEBNext Ultra II DNA library prep kit (NEB). Biotinylated capture probes 70 nt in length were designed against every DpnII restriction fragment in a 2.5 Mb window centered on Runx1 (chr16:91,566,000-94,101,999) ...
-
bioRxiv - Developmental Biology 2019Quote: ... libraries were generated using the NEBNext Ultra II library preparation kit with 15 cycles of PCR amplification (NEB E7645). The libraries for the ‘MicroChIP’ samples were generated using the MicroPlex library prep kit (Diagenode C05010012 ...
-
bioRxiv - Microbiology 2020Quote: ... an equimolar pool of all amplicons was prepared and purified using Monarch PCR & DNA Cleanup Kit (New England Biolabs). After DNA quantification using Qubit dsDNA HS Assay Kit and Qubit 2.0 fluorometer (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled PCR products (1 μg) were digested with the NEBNext dsDNA fragmentase kit (New England BioLabs, Inc., Ipswich, MA). Fragmented DNA was end-repaired with the NEBNext End Repair Module (New England BioLabs ...
-
bioRxiv - Biochemistry 2019Quote: ... PCR amplified ORF was cloned into a pGEX4T1 vector using NEB HF cloning kit (New England Biolabs, Inc. USA). E69A-TRAF6 was cloned using PCR based site-directed mutagenesis ...
-
bioRxiv - Cancer Biology 2022Quote: ... The PCR product was then gel purified with NEB Monarch® DNA Gel Extraction Kit (NEB, Cat No. T1020). Alongside pLentiCRISPRv2 (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... We cleaned the samples and inputs using the Monarch PCR & DNA clean-up kit (New England BioLabs, Ipswich, MA), prepared libraries using the ThruPLEX DNA-seq Kit (Rubicon Genomics ...
-
bioRxiv - Neuroscience 2021Quote: ... mutations were respectively inserted in the LEV-1 and UNC-29 subunits by PCR using the Q5 site-directed mutagenesis kit according to the manufacturer’s recommendations (New England Biolabs). The forward and reverse primers used were 5’- GTTCTTTGAGGCAACAGTTGG −3’ 5’- CCGTACAACAAAAACCGATCCA −3’ for G461E substitution in lev-1 cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR products were assembled by Gibson assembly using NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, USA).
-
bioRxiv - Microbiology 2022Quote: ... and the fucI PCR product was cloned into the plasmid using the NEBuilder HiFi DNA Assembly Kit (NEB; E5520S), followed by transformation into the E ...
-
bioRxiv - Genomics 2019Quote: ... The reverse transcribed samples were subjected to PCR for 15 cycles by adding 50μL of the PCR mastermix from the NEB small RNA for Illumina library prep kit (NEB), 5μL of the Universal adapter and 5μL of a unique indexed adapter (see NEB library pooling guidelines for suitable adapter combinations for three sample sequencing runs) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Genomic DNA templates were obtained from Muc14a fragments previously cloned in a pMiniT 2.0 vector using PCR Cloning Kit (NEB) and primers kmer Muc14_F and 58537687_F ...