Labshake search
Citations for New England Biolabs :
1001 - 1050 of 4230 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... Coli NEB® 5-alpha aliquot (NEB®, #C2987H). Plasmids were sanger sequenced by GeneWiz (Azenta Life Sciences ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 5 µl of 10x T4 ligase buffer (NEB B0202S), 1 µl of T4 PNK ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 5 units of polymerase (New England Biolabs M0273). Vent reactions were performed in 1X Thermopol buffer (New England Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 µM Mth RNA Ligase (New England Biolabs). The 100 µl master mix was split into 4 aliquots (25 µl each ...
-
bioRxiv - Genomics 2024Quote: ... 5 µl 10x NEBuffer2 and 1 µl M.SssI (NEB) in a total volume of 50 µl (topped off with ddH2O) ...
-
bioRxiv - Genetics 2024Quote: ... 5 µL of Exonuclease I Reaction Buffer (NEB, B0293S) was mixed with 1 µL 1:200 diluted UltraPure BSA solution (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2024Quote: ... 5 µL of Lambda Exonuclease Reaction Buffer (NEB, B0262S) was mixed with 1 µL of nuclease-free water ...
-
bioRxiv - Cell Biology 2024Quote: 5-alpha Competent E.coli High Efficiency (NEB, Cat# C2987I)
-
bioRxiv - Cell Biology 2021Quote: ... RHA PCR products were ligated into pAAV p21 vector by Gibson assembly at a ratio vector:inserts of 1:2:2 using T4 DNA ligase (NEB). All constructs were checked by sequencing before transfection into cells ...
-
bioRxiv - Biochemistry 2021Quote: ... sDrl-2 for crystallization was also partially deglycosylated with PNGase F (New England BioLabs: 2,000 unit/mg sDrl-2) for 3 h at room temperature before sizing.
-
bioRxiv - Biochemistry 2021Quote: ... 2 μl of this lysate was directly used for PCR reactions with 2× Taq start master mix (M0496L, NEB), and the two NASP clone screening primers (see primer table) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... These were phosphorylated (2 μL 100 μM oligo stock, 2 μL 10X T4 DNA ligase buffer (New England Biolabs), 1 μL T4 PNK (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 nM dT adaptor primer and 200 nM Vλ1-GSP4-2-Hind III and 2 U Taq polymerase (NEB), in a final volume of 50 µl ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μl each of two complementary oligonucleotides (Mut_sgRNA_F and Mut_sgRNA_R) (Supplementary file 1) at a concentration of 20 μM and 2 μl of NEBuffer 2 (NEB B7002S) were added into an Eppendorf tube ...
-
bioRxiv - Microbiology 2024Quote: ... The gel-extracted nascent RNA in 5 µl nuclease-free water was ligated to 10.7 pmol barcode DNA linker (Supplementary Table 2) using 200 U truncated T4 RNA ligase 2 (NEB) overnight at 16°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... cloned into the pJR16 vector in two steps (Gift from R. Johnston, Johns Hopkins University) using HiFi DNA Assembly (New England Biolabs). pJR16 uses an EGFP reporter with a nuclear localization sequence (nls) ...
-
bioRxiv - Cell Biology 2020Quote: To prepare single guide RNA targeting MTFR2, DNA oligoes (F: CACCGACGACATTTACCTGTTCTAC, R: AAACGTAGAACAGGTAAATGTCGTC) were annealed and cloned into BsmBI (NEB) cut pLenti-sgRNA to make pLenti-sgMTFR2 following published protocols (Ran ...
-
bioRxiv - Biochemistry 2020Quote: ... Modification of the coding sequence of the multibasic S1/S2 cleavage site PRRAR to PGSAS or to a single R was carried out by PCR mutagenesis using Q5 polymerase (New England Biolabs). Introduction of cysteine crosslinks and modification of residues 986 and 987 were carried out using Q5 polymerase PCR with primers containing desired substitutions ...
-
bioRxiv - Neuroscience 2021Quote: ... Either the wild-type or the mutant version of the PRNP 3’U R were inserted into the digested pmirGLO vector by performing a Gibson Assembly following manufacturer`s instructions (NEB). After transformation of the cloned vectors and purification of the DNA using EndoFree Plasmid Maxi Kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... a 2.4-kb PCR fragment spanning Rv3377c-Rv3378c was generated using primers BamHI-Rv3377c-Rv3378c-F and HindIII-Rv3377c-Rv3378c-R (Sup. Table 1) using high-fidelity Phusion DNA polymerase (New England Biolabs). The fragment was subsequently digested with BamHI and HindIII (all restriction enzymes from New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The splicing isoforms were then amplified with minigene-specific primers (F: CTGGCTAACTAGAGAACCCACTGC; R: GGCAACTAGAAGGCACAGTCG) and 32P-labeled dCTP using Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer′s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... EGFP-Sec22b-shR and EGFP-Sec22b-P33-shR were generated by site-directed mutagenesis (F: CTTCTGAATGAAGGTGTCGAACTCGATAAAAGAATAAGGCCTAGACACAGTGGGC; R: GCCCACTGTGTCTAGGCCTTATTCTTTTATCGAGTTCGACACCTTCATTCAGAAG) using the Q5 Site-Directed Mutagenesis Kit (NEB). pEGFP-ORP8-H514A-H515A (ORP8-Mut ...
-
bioRxiv - Genetics 2020Quote: ... the ‘T2A-GFP-WPRE’ sequence was amplified from the hVMD2-hBEST1-T2A-GFP plasmid using LCv2-GFP.Gib.F and .R primers and Q5 2X MM (NEB, Cat# M0492L). The ‘2A-Puro-WPRE’ sequence was then removed from the LCv2 plasmid via restriction digestion with PmeI (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... 10μg of undigested total RNA samples and the above-mentioned RNase R-treated RNA were added with RNA loading dye (NEB) and denatured for 10min at 70°C ...
-
bioRxiv - Immunology 2023Quote: ... Candidate founders giving positive products in all three PCR reactions were further characterised by amplifying again with the JG01 F/R primers using high fidelity Phusion polymerase (NEB), the larger product gel extracted and subcloned into pCRblunt (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pET21c-GPR-EGFP vector was PCR-linearized with pET-F/R and pre-digested with HindIII-HF and XhoI (NEB). The insert was ligated to the vector in a 3:1 ratio (insert:vector ...
-
bioRxiv - Cell Biology 2023Quote: ... and GST-Elm1-R (GATGCGGCCGCTCGAGCTATATTTGACCATTATCTGCAAAG) to amplify each Elm1 phospho-mutant and cloned into pGEX-4T1 using BamHI and XhoI (New England Biolabs). All plasmid constructs and mutagenesis were confirmed correct via sequencing at the DNA Sequencing Facility ...
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... DNA fragments were amplified with 15-20 bp of homology regions in primers using Phusion R High Fidelity DNA polymerase (New England Biolabs; NEB) and homology based assemblies were performed using NEBuilder® HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... with the Metadynminer R package.52 Minimum free energy paths (MFEPs) were obtained through the Metadynminer package with the nudged elastic band (NEB) method linking intermediate wells.53 Concerted pathways were obtained by NEB directly from the reactants to the products ...
-
bioRxiv - Cell Biology 2024Quote: ... StrepII-EPLINα WT plasmid was created by inserting the EPLINα PCR product (created with EPLINα Strep F/R primers) into pcDNA3 StrepII MCS vector cleaved with EcoRI/AgeI using NEBuilder HiFi DNA Assembly (NEB). The deletion mutants (ΔNHX ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was converted into Illumina-compatible libraries with the NEBNext(R) Ultra(TM) II DNA Library Prep Kit (NEB E7645L) following the protocol described by 41 and using NEBNext Dual Index Multiplex Oligos (NEB E7600S) ...
-
bioRxiv - Cell Biology 2024Quote: ... F and mCh oma-1(378) R (Table S2) and then cloned into pVIG57 (gift of Vincent Galy) using a HiFi reaction (New England Biolabs). The resulting plasmid pCFJ150_Pmex-5:CTPD::mCh::LGG-2 was injected for MosSCI (19 ...
-
bioRxiv - Cell Biology 2024Quote: ... zact sequence was amplified with primers containing attB sites (F: GGGGACAAGTTTGTACAAAAAAGCAGGCTC-CATGGATGAGGAAATCGCTG; R: GGGGACCACTTTGTACA-AGAAAGCTGGGTAGAAGCACTTCCTGTGGACGATG) using a high-fidelity polymerase (Phusion, NEB). To create a middle entry clone pME-zact ...
-
bioRxiv - Biophysics 2024Quote: ... The PCR product of this amplification was purified by gel extraction and assembled with the scrambled R-domain using Gibson assembly (NEB) at a 1:5 g/g and 1:10 g/g ratio ...
-
bioRxiv - Neuroscience 2020Quote: ... with TdTomato was amplified by PCR with primers (5’- ggcgcgCCCCCCTCTCCCTCCCCCCC -3’ and 5’- ggcgcgccTTACTTGTACAGCTCGTCCATGCCGTACAG -3’) using Hot start Q5® polymerase (NEB, Frankfurt, Germany) from LeGO-iT (a gift from Boris Fehse ...
-
bioRxiv - Cell Biology 2020Quote: ... After ligation at RT for 4 h with T4 ligase (NEB), the nuclei were pelleted ...
-
bioRxiv - Genomics 2020Quote: ... with 4 μl (400 U/μl) of T4 DNA ligase (NEB) in a final volume of 200 μl at 16°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 μL of 20 mg/mL Proteinase K (New England BioLabs) was added and incubated for 1 h at 55 °C ...
-
bioRxiv - Immunology 2022Quote: ... 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Bioengineering 2021Quote: ... 2.5 µL of 4 mM dNTPs (New England Biolabs, Ipswich, MA), and SuperScript II RT Enzyme (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2020Quote: ... and 4 μl of T4 DNA polymerase (NEB M0203, 3U/μl), and incubating at 37 °C for 1 hour with rotation ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplied with the enzyme) and 4 units of DNAse I (NEB) were incubated at 37 °C for 60 min ...
-
bioRxiv - Cell Biology 2021Quote: ... pCFD4_Lamp_13 pCFD4_lamp1-30_4-4 were made by Gibson assembly (NEB # E5510S) using oligos Lamp1_crips_61_for ...
-
bioRxiv - Immunology 2022Quote: ... 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Molecular Biology 2022Quote: ... and α1-3,4 fucosidase (New England Biolabs, 4 U/μg protein). All enzymatic reactions were performed as a 1-step reaction with 1x Glycobuffer 2 (New England Biolabs) ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μL of 20 mg/mL Proteinase K (New England BioLabs) was added and incubated for 1 hours at 55°C ...
-
bioRxiv - Pathology 2021Quote: ... 4 μM of each gRNA was combined with Cas9 (NEB #M0646) and Cas9 buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μL NEBNext Second Strand Synthesis Enzyme Mix (New England Biolabs), and 48 μL water ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µl exonuclease T with 10 µl buffer 4 (NEB) was used in the enzymatic reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of 20 mg/mL Proteinase K (New England BioLabs) was added and incubated for 1 h at 55 °C ...