Labshake search
Citations for New England Biolabs :
1251 - 1300 of 4230 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... stained with a mAb cocktail composed of SARS-CoV-2 spike (Creative-Bios; 2BCE5) and SARS-CoV-2 nucleoprotein (Creative-Biolabs; NP1C7C7) followed by anti-Mouse IgG-HRP (Abcam ab6823 ...
-
bioRxiv - Genomics 2021Quote: ... and supernatant was transferred to a new tube and added to 2 μL 10% SDS and 2 μL 20 mg/mL proteinase K (New England Biolabs P8107). Samples were incubated overnight at 65°C to reverse crosslinks ...
-
bioRxiv - Genetics 2023Quote: ... 5 µl of 100 ng/µLcDNA diluted from the previous step was combined with 2 µL of block mix and 2 µL of nuclease free water (NEB, AM9937), and then the cDNA block oligo mix was incubated on a thermocycler under the following conditions to allow block oligo mix to bind to the 5′ end and the 3′ end of the cDNA molecule ...
-
bioRxiv - Microbiology 2023Quote: ... antibiotic resistance cassette and 2 flanking regions were combined in equimolar amounts and mixed with 2 x HiFi reagent (NEB, UK) and incubated at 50°C for 1 hour ...
-
bioRxiv - Synthetic Biology 2021Quote: ... for 4 hours at 37°C and treated with Antarctic phosphatase (NEB) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Annealed oligos were mixed with 4 μL 6X loading dye (NEB, B7024S), loaded onto a lab-made 8% TBE gel (Acrylamide/Bis solution 37.5:1 ...
-
bioRxiv - Genomics 2020Quote: ... the circularized DNA was incubated in 1x NEBuffer 4 reaction buffer (NEB) (50 mM potassium acetate ...
-
bioRxiv - Systems Biology 2020Quote: ... a 4-cycle PCR was performed with OneTaq polymerase (New England Biolabs) in 200 reactions (125 μL/reaction) ...
-
bioRxiv - Microbiology 2021Quote: ... The parental plasmid was digested for 4 h using Dpn1 endonuclease (NEB) at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... a mix of 4 μl First strand Synthesis Reaction Buffer (NEB-kit), 0.5 μl Murine RNase Inhibitor (NEB-kit ...
-
bioRxiv - Genomics 2020Quote: ... 4 μL of 20 mg/mL RNase A (New England Biolabs #T3018L) is added to the RNase positive aliquot of non-lysed TSB from 1-gram cannabis flower homogenate ...
-
bioRxiv - Developmental Biology 2021Quote: ... by incubating with DNA polymerase I Klenow (4 mL; New England Biolabs) for 90 min at 37C with rotation ...
-
bioRxiv - Immunology 2021Quote: ... Step 3 was cloned into Step 4 with T4 DNA ligase (NEB) and then this recominbeering fragment (5’ arm of homology ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 uL BbsI-HF (NEB R3539L, 1 uL T4 ligase (NEB M0202M), and 1uL of an XTEN linker-encoding DNA amplicon ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 uL BbsI-HF (NEB R3539L, 1 uL T4 ligase (NEB M0202M), and 1uL of an XTEN linker-encoding DNA amplicon ...
-
bioRxiv - Genetics 2023Quote: ... 4 µl Luna universal qPCR Master Mix (New England Biolabs, Hitchin, UK) and 1.8 µl ultrapure water ...
-
bioRxiv - Developmental Biology 2024Quote: ... 47 ml water) and 4 µL 10mg/ml Proteinase K (P8108S, NEB). The samples were incubated for 8 hours at 55 °C followed by 10 min at 98 °C to inactivate the Proteinase K ...
-
bioRxiv - Biochemistry 2024Quote: ... then subsequent addition of 4 units of proteinase K (New England Biolabs) and incubation at 55 °C for 30 min ...
-
bioRxiv - Biophysics 2024Quote: ... 4 mM BME) and added to an amylose resin (New England Biolabs), incubating overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... and subsequently incubated with 4 U of alkaline phosphatase (New England Biolabs) at 37°C for 30 min to hydrolyze unreacted NTPs ...
-
bioRxiv - Cell Biology 2024Quote: ... 40U (4 µL) T4 polynucleotide kinase enzyme (T4 PNK; NEB, Cat #M0201S), 4 µL 10X T4 Ligase Buffer (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... the cDNA of RDGB corresponding to amino acids 947-1259 was subcloned in pJFRC::GFP vector using the restriction enzymes BglII and NotI (NEB). A flexible linker of Gly(G)-Ser(S ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA coding region corresponding to RDGBPITPd-FFAT (amino acids 1-472) was subcloned into pUAST-attB by using the restriction enzymes NotI and XbaI (NEB). Similarly ...
-
bioRxiv - Microbiology 2022Quote: ... of the SNAP-Tag-SCE-I-KanR shuttle sequence with a nine amino acid linker (HTEDPPVAT) and subsequent second recombination to clear the Kanamycin resistance and restore the SNAP-Tag sequence (NEB; for complete insertion sequence see Table 1) ...
-
Long-Range Electrostatic Interactions Significantly Modulate the Affinity of Dynein for MicrotubulesbioRxiv - Biophysics 2021Quote: ... We mutated aspartic acid 3420 to alanine (D3420A) and glutamic acid 3320 to alanine (E3320A) using a Q5 site-directed mutagenesis kit (E0552S, New England Biolabs, Ipswich ...
-
bioRxiv - Microbiology 2020Quote: ... Constructs with single amino acid substitutions in SctD or SctF were created by overlapping PCR using Phusion polymerase (New England Biolabs), and expressed from an arabinose controlled expression vector (pBAD).
-
bioRxiv - Biochemistry 2022Quote: ... the serine residues S240 and S250 in Dsn1 were mutated to aspartic acid using the Q5 site-directed mutagenesis kit (New England Biolabs) as described previously 19,20 ...
-
bioRxiv - Microbiology 2022Quote: ... and a subpart of it encoding specifically the PAS domain (amino acids 1-138) the corresponding coding sequence was amplified by PCR using the Phusion DNA polymerase (New England Biolabs) and cloned between the NdeI and BamHI sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... 8 μg of digested nucleic acids were treated or not with 10 μl of RNase H (New England BioLabs, M029L) overnight at 37 °C in 1x RNAse H buffer and 1/10 of the samples were used as input ...
-
bioRxiv - Molecular Biology 2022Quote: ... Amino acid substitutions and domain deletions were made using either Gibson assembly or the Q5 Site-Directed Mutagenesis Kit (NEB). Isogenic single and double mutant strains were generated via haploid mating ...
-
bioRxiv - Genomics 2021Quote: ... Site-directed mutagenesis for amino acid substitution was performed using the Q5® Site-directed mutagenesis kit (New England Biolabs) according to the manufacture’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmid was made by inserting the TauRD sequence (Tau amino acids 244-371) in pHUE82 by Gibson assembly using the Gibson Assembly Master Mix (New England Biolabs). Plasmid pHUE-TauRD (C291A/P301L/C322A/V337M ...
-
bioRxiv - Cell Biology 2020Quote: ... A fragment of human Plexin-B1 cDNA (encoding amino acids 1-535) was cloned into the pcDNA5 vector using HindIII (R0104S, NEB) and XhoI (R0146S ...
-
bioRxiv - Cell Biology 2021Quote: ... Single or multiple amino acid mutants of TULP3 and ARL13B were generated by Q5 site directed mutagenesis (New England Biolabs). For biotinylation experiments ...
-
bioRxiv - Microbiology 2023Quote: ... A stop codon was inserted after amino acid residue 370 by site directed mutagenesis using Q5 Site-Directed Mutagenesis Kit (NEB), in order to express the truncated N1-370 construct ...
-
bioRxiv - Biophysics 2023Quote: ... and 575-585 for ΔX-Y contact) were replaced with a 12 amino acid GSSG linker using the KLD enzyme mix (NEB). Expression and purification were carried out the same as for the wildtype protein ...
-
bioRxiv - Biochemistry 2023Quote: ... serine or aspartic acid were generated by engineering the corresponding constructs using Q5 site-directed mutagenesis (New England Biolabs, E0554). For this purpose ...
-
bioRxiv - Microbiology 2024Quote: Amino acids substitutions in ompT were generated using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA). Briefly ...
-
bioRxiv - Biophysics 2024Quote: ... Plasmid region corresponds to the 71-1184 amino acids of BimC and the modified vector was amplified and assembled with KLD Enzyme Mix Reaction (NEB) to generate the recombinant BimC(Δ1-70)-GFP construct ...
-
bioRxiv - Cell Biology 2024Quote: ... was inserted into murine Shh between amino acids 92N and 93T (corresponding to N91 and T92 in human Shh) by using Gibson assembly (HiFi Assembly Kit, NEB). Where indicated ...
-
bioRxiv - Cell Biology 2024Quote: ... The concentration of RNA was assessed by comparing the known nucleic acid concentrations of the DNA ladder bands (NEB, N3232L). Microinjection protocol was followed as mentioned previously 19 using Nanoject II injector (Drummond Scientific Company ...
-
bioRxiv - Plant Biology 2024Quote: ... Aspartic acid 1209 of MBD9 was mutated to Alanine through GAT→GCT DNA sequence change using the New England Biolabs (NEB) Site Directed Mutagenesis Kit and D1209A Mutagenic primers listed in Supplemental Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... the DNA sequence coding for amino acids 384 to 667 of Fbxo42 was cloned into pETM-30 at XhoI/NcoI (NEB) restriction sites ...
-
bioRxiv - Cell Biology 2024Quote: ... a PCR product containing the sequence encoding amino acids 104-330 of MPS1 from Drosophila melanogaster was inserted into the pMal-c2 vector (New England Biolabs) by FastCloning (Li et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... The signal peptide was removed (amino acids 1-35) by mutagenesis using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Biochemistry 2024Quote: ... A truncated version of this wild-type VgrS lacking the first 81 amino acids was created by Q5-mutagenesis (NewEngland Biolabs, NEB) to generate VgrS (residues 81-729 ...
-
bioRxiv - Bioengineering 2024Quote: ... Gibson assembly was performed by combining a part amplicon and linearized pEmpty in a 2:1 mass ratio in 2× NEB Gibson Assembly Master Mix (NEB, Cat# E2611S) and incubating at 50℃ for 2 hr before transformation ...
-
bioRxiv - Developmental Biology 2021Quote: ... touchdown PCR (with primers atg13 F- GGCTCGTGCGACAATGGATAGTG; R- GACCTCGGGGATGTCCTTTATTGC) was followed by a HindIII restriction digest (R3104S, New England Biolabs, MA, USA), and fragments were separated by gel electrophoresis on a 3% agarose gel ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 uL of T4 RNA ligase I (NEB M0204S) totaling 20 uL and incubated for 1 hour at 30 C.
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl 10X RtcB reaction buffer (New England Biolabs), 2 μl 1mM GTP ...