Labshake search
Citations for New England Biolabs :
1001 - 1050 of 7574 citations for 7 Chloro 1 3 dihydro 1 methyl 5 phenyl 2H benzo 1 4 diazepin 2 one 4 oxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... 1 U of Taq polymerase (NEB), 0.25 μM forward primer ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL T4 DNA polymerase (NEB) and 2.5 μL Ampligase (Lucigen ...
-
bioRxiv - Neuroscience 2022Quote: ... Primer Set 1 (New England Biolabs). Libraries were sequenced on an Illumina HiSeq 2500 instrument using 50-bp single-end reads.
-
bioRxiv - Bioengineering 2022Quote: ... 100 μg.μL-1 BSA (NEB, B9000S) to a final volume of 10 μL per smgRNA.
-
bioRxiv - Bioengineering 2022Quote: ... 100 μg.μL-1 BSA (NEB, B9000S) to a final volume of 10 μL per condition.
-
bioRxiv - Genomics 2022Quote: ... 1% BSA (20 mg/ml, NEB)) + hash oligos (1 uM ...
-
bioRxiv - Genomics 2022Quote: ... 1× Φ29 buffer (New England Biolabs), 1 mM dNTPs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 μL of DpnI (NEB, R0176S) was added to the PCR reaction and incubated at 37°C for one hour ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 µl PNGase F (P0708, NEB) was then added ...
-
bioRxiv - Neuroscience 2022Quote: ... GSK-3β (NEB 27C10, 1:100,000), GAPDH (Millipore MAB374 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 µL HindIII-HF (NEB) in CutSmart buffer in 20 µL at 37°C overnight ...
-
Species-specific protein-protein interactions govern the humanization of the 20S proteasome in yeastbioRxiv - Genetics 2022Quote: ... and 1 μl of ATP (NEB), 1ul of FD buffer (Thermo ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 U/μL RNase Inhibitor (NEB) in reaction buffer (50 mM Tris-HCl pH7.5 ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl T4 Polynucleotide Kinase (NEB) and nuclease free H2O to a final volume of 20 μl ...
-
bioRxiv - Microbiology 2023Quote: ... 1 U Phusion DNA polymerase (NEB), and 10 ng template DNA ...
-
bioRxiv - Genetics 2023Quote: ... 1%BSA (NEB, catalog no. B9000S), 0.2U/µL RNase inhibitor (Ambion ...
-
bioRxiv - Biophysics 2023Quote: ... 1 U/μL RNase inhibitor (NEB), and 10 ng/μL of a plasmid containing a T7 promoter followed by the nanoluciferase (nLuc ...
-
bioRxiv - Biophysics 2023Quote: ... 1 U/μL RNase inhibitor (NEB), 1 μM (MetRS) ...
-
bioRxiv - Genomics 2023Quote: ... 1 µM Cas9 Nuclease (NEB, M0386S) (2µL ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 x Q5 Reaction buffer (NEB), 200 nM dT adaptor primer and Vλ1 specific primer (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl β-agarase (NEB M0392S) was added and mixed by flicking without allowing sample to cool ...
-
bioRxiv - Neuroscience 2023Quote: ... Phospo-AKT (9271, NEB, 1:5000); cFOS (134122 ...
-
bioRxiv - Neuroscience 2023Quote: ... phospo-ERK (9101, NEB, 1:10000); AKT (9272 ...
-
bioRxiv - Immunology 2023Quote: ... 1 μl T7 Endonuclease I (NEB) and 7 μl HPLC-grade H2O were added ...
-
bioRxiv - Immunology 2022Quote: ... 1 µl Phusion DNA Polymerase (NEB); 2 µl 10 mM dNTPs ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μl β-agarase (NEB M0392S) was added and mixed by flicking without allowing sample to cool ...
-
bioRxiv - Biophysics 2023Quote: ... Streptavidin (1 mg/mL, NEB N7021S) was diluted 1:10 in DPBS and applied to passivated flow chambers for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM NAD (New England Biolabs), 2.0 U T5 exonuclease (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1×Phusion HF Reaction Buffer (NEB),0.2 mM dNTPs (NEB) ...
-
bioRxiv - Bioengineering 2023Quote: ... 1× Taq buffer (New England Biolabs), 2 mM manganese(II ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 u XbaI (New England Biolabs), 1.33 u BssHII (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μL DpnI (New England Biolabs), and 5 μL MilliQ water ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 mM ATP (New England Biolabs), 10U BBSI-HF (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1× CutSmart buffer (New England Biolabs), 1 mM ATP (New England Biolabs) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 1 uL RNase H (NEB) and incubated at 37C for 15 minutes ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... adding 1-2ul ApaLI (NEB #R0507L) and 5ul 10X Cutsmart to 43-ul samples and incubating at 37°C for at least 2 hr (or up to overnight).
-
bioRxiv - Immunology 2023Quote: ... 1 µL RNA ligase I (NEB), 0.5 µL IRDye800-labeled oligonucleotide (34) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL T4 Ligase (NEB, #M0202L), and 1 µL T4 PNK (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... and in 1 × CutSmart buffer (NEB). The reaction mixture was pipetted ten times to ensure thorough mixing ...
-
bioRxiv - Genomics 2024Quote: 1 μl of Cas9 nuclease (NEB) and 2 μl of single-guide RNA (check concentration ...
-
bioRxiv - Microbiology 2024Quote: ... in 1 x rCutSmart buffer (NEB) at 37 °C for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1:100 Murine RNase Inhibitor (NEB)) ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 µL 10 mM dNTPs (NEB), 2 µL each 10 µM forward and reverse primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... along with 1 kb (NEB, N3232L) and 100 bp (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 kb plus DNA ladder (NEB)
-
bioRxiv - Plant Biology 2024Quote: ... 1 x cut smart buffer (NEB), and RNase inhibitor (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL T4 DNA Ligase (NEB), 100 ng DNA (oligo 3) ...
-
bioRxiv - Genomics 2023Quote: ... 1 mM dNTPs (New England Biolabs), 3.5 μM of Phi29 Random Hexamer Primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3’ RNA adaptor (/ 5Phos/NNNNNNNNGAUCGUCGGACUGUAGAACUCUGAAC/3InvdT/) is ligated at 5 μM concentration for 1 hours at room temperature using T4 RNA ligase (NEB), followed by 2 consecutive streptavidin bead bindings and extractions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 (1) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). In addition ...